ID: 979662696

View in Genome Browser
Species Human (GRCh38)
Location 4:123276371-123276393
Sequence CTGGATATTATATCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979662696 Original CRISPR CTGGATATTATATCTTTTGT GGG Intronic
902047630 1:13537758-13537780 CTAGATATTATCTCCTTTTTGGG + Intergenic
903680595 1:25093969-25093991 CTGCATACAATATCTTGTGTTGG + Intergenic
906605166 1:47164261-47164283 CTGTAAATGATATCTTTTTTTGG - Intergenic
907012236 1:50974502-50974524 CTGAATATTTTATCTTTCCTTGG + Exonic
907366961 1:53969618-53969640 CTGATTTTTGTATCTTTTGTAGG + Intergenic
907613131 1:55893221-55893243 CTGGATATTAAATTCTTGGTTGG + Intergenic
908013028 1:59802205-59802227 CTGGATATTAGATCTTTGTTAGG - Intergenic
908336507 1:63130612-63130634 ATGCATATTTTATCTTTTGTTGG - Intergenic
908407235 1:63827176-63827198 CTGGATATTAGACCTTTGCTGGG + Intronic
909414684 1:75392273-75392295 CTGGATATTAGACCTTTGTTGGG - Intronic
909580869 1:77233101-77233123 CCAGATATTTAATCTTTTGTTGG + Intergenic
910117390 1:83747408-83747430 TTGGATTTTTTATCTTTTGGGGG - Intergenic
910128922 1:83879938-83879960 ATGGATCTTGTAGCTTTTGTGGG - Intronic
910516352 1:88065289-88065311 GGGGATATAATATCTTTTATAGG + Intergenic
911493646 1:98602020-98602042 CTGGATTTTATTTCTTTTAAAGG - Intergenic
911953902 1:104211502-104211524 CTGGTTTTTACATCTTTTATTGG + Intergenic
915989456 1:160498950-160498972 CTGGATATTAGACCTTATGTTGG + Intronic
916593767 1:166221760-166221782 CTGGATATTAGACCTTTGTTAGG + Intergenic
916853007 1:168723156-168723178 GTGGATTTGATATCTTTTTTAGG + Intronic
916904211 1:169263970-169263992 CTGGATATGAAATTTTTGGTTGG - Intronic
917113228 1:171574105-171574127 CTGGATCTTATAGATTATGTTGG + Intronic
918019280 1:180669229-180669251 CTGGTTATTTTATCTATTATTGG + Intronic
918668855 1:187187408-187187430 AAGGATATCATGTCTTTTGTGGG + Intergenic
919260998 1:195193375-195193397 CTGAAGATTATAACTTTTGAAGG + Intergenic
919432342 1:197511643-197511665 CTGGATCTTATACTCTTTGTTGG - Intronic
921366565 1:214380005-214380027 AAGAATATTATATCTTTTGGTGG - Intronic
921823465 1:219643956-219643978 CTTGATATTATTTCATTTTTGGG - Intergenic
922201072 1:223401853-223401875 CTGCATATTATATCCTCTCTTGG + Intergenic
922318866 1:224466966-224466988 CTAGATACTAAATCCTTTGTTGG + Intronic
923153941 1:231259264-231259286 CTGCATATCCTATCTTTTGGGGG - Intronic
923955594 1:239015082-239015104 CTGCATATTAAATCTATTTTAGG + Intergenic
924619273 1:245646664-245646686 CTGGATATCCTATATTTTTTTGG - Intronic
1065182613 10:23142004-23142026 CTGGATATTAGACCTTTATTGGG - Intergenic
1066286538 10:33971887-33971909 GTGGATATACTTTCTTTTGTTGG + Intergenic
1066290739 10:34012428-34012450 CTTGATTTTATATATTTTATGGG - Intergenic
1067245708 10:44540740-44540762 CTGGATATTAGACCTTTTTTGGG + Intergenic
1067915173 10:50389743-50389765 TTGGAGATTTTATGTTTTGTGGG - Intronic
1068377860 10:56208421-56208443 ATAGATATTTTATTTTTTGTTGG + Intergenic
1068441940 10:57068120-57068142 ATGTTTATTAGATCTTTTGTGGG + Intergenic
1068807494 10:61215123-61215145 CAGGAAATAATATCTTTAGTTGG + Intergenic
1071377891 10:85029021-85029043 CTGGATATTATAATCTTTGATGG - Intergenic
1071752374 10:88495071-88495093 CTAGGAATTATATCTGTTGTAGG - Intronic
1071861755 10:89681396-89681418 CTTAATTTTACATCTTTTGTAGG - Intergenic
1071991770 10:91106661-91106683 TTGGATATTAGACCTTCTGTAGG + Intergenic
1072111490 10:92324668-92324690 CTGTATATCATAATTTTTGTTGG + Intronic
1072368397 10:94738681-94738703 CTGGATATTAGACCTTTGTTGGG + Intronic
1073019154 10:100427068-100427090 CTGGATATTATACCTTTGTTGGG - Intergenic
1073689206 10:105788696-105788718 CTGGATATTAGTTCTCCTGTTGG - Intergenic
1074466486 10:113687173-113687195 CTGGATATAATATTTGTGGTTGG + Intronic
1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG + Intergenic
1075957999 10:126541449-126541471 CTGGATATTAAACCTTTATTTGG - Intronic
1078167323 11:8899572-8899594 CTGGATATAAAATTTTTAGTTGG - Intronic
1079793067 11:24764033-24764055 ATGGATAATATTTATTTTGTTGG + Intronic
1080313000 11:30915779-30915801 CTGGAGATTATAAGTTCTGTTGG + Intronic
1080494616 11:32804425-32804447 CTAGAAATTATATCTTTGGCTGG - Intergenic
1081096880 11:38947230-38947252 TTGTATATTACATCCTTTGTTGG - Intergenic
1081223143 11:40487920-40487942 TTGGAGATTATATAATTTGTGGG - Intronic
1081343868 11:41958570-41958592 CTGGATATGAAATTCTTTGTTGG - Intergenic
1082109071 11:48253192-48253214 CTAGATATTTTATTTTTTGGTGG + Intergenic
1083507867 11:63177014-63177036 CTGGATATAATACTTTTTGTTGG + Intronic
1083817243 11:65141337-65141359 CTGGATAATTTATTTTTTGTAGG - Intergenic
1084264201 11:67996554-67996576 CTGGCTATCTTGTCTTTTGTCGG + Intronic
1087199339 11:95330043-95330065 CTGGATTTTATACCATTTGGGGG - Intergenic
1087337650 11:96864728-96864750 CTGGTTATTTTATTTTTTATGGG + Intergenic
1090811583 11:130249366-130249388 CTTGAAATTAAATATTTTGTTGG + Intronic
1091149305 11:133312279-133312301 GTGGATATTCTTTCTTTTGGGGG - Intronic
1091707523 12:2707469-2707491 CTGGTTATTCTATCTATTATTGG - Intergenic
1091709513 12:2728407-2728429 CTGGATATTAGACCTTTGTTGGG + Intergenic
1091893106 12:4077928-4077950 CTGGATATTAGACCTTTGTTAGG - Intergenic
1093561018 12:20539932-20539954 CTGGATATTTTATAATTTCTAGG - Intronic
1093719454 12:22422247-22422269 CTGGATATTAGACCTTTGTTGGG - Intronic
1095107669 12:38255023-38255045 CTGGGTATTTTATCTTTTTATGG + Intergenic
1095298267 12:40551830-40551852 CTGGATATTAGATCTTTGTCAGG + Intronic
1097533445 12:60835497-60835519 CTAGATATTAGTTCTTTTGTAGG - Intergenic
1097644492 12:62220541-62220563 CTTGATGTTATATATTTTGTGGG - Intronic
1099486716 12:83237815-83237837 CTGGATATTATATCTTTGTCAGG + Intergenic
1100937264 12:99683244-99683266 TTGGATATTCTCTCTTTTCTTGG - Intronic
1101017946 12:100520965-100520987 AGGGATATTATCTATTTTGTGGG + Intronic
1101275533 12:103197186-103197208 CTGGATATAAAATTTTTGGTTGG + Intergenic
1105478783 13:20754237-20754259 CTGGGTATAGAATCTTTTGTTGG + Intronic
1106363776 13:29058057-29058079 CTGGATATTAAATTCTTGGTTGG + Intronic
1106574567 13:30962565-30962587 CTGGTTCTTACTTCTTTTGTAGG + Intronic
1106963139 13:35025063-35025085 CTAGATATTAGACTTTTTGTAGG + Intronic
1107286470 13:38798846-38798868 TTGGGTCTTCTATCTTTTGTTGG + Intronic
1107790086 13:43993224-43993246 TTGGATATTAGATCCTTTGTTGG - Intergenic
1108803031 13:54122733-54122755 CTAGATATACTATCTTATGTAGG - Intergenic
1109036529 13:57268924-57268946 CTGGATATTAGACCTTTGTTGGG + Intergenic
1109057506 13:57570382-57570404 CTGGATATTAGACCTTTGTTGGG + Intergenic
1109629335 13:65024100-65024122 CTGGATATGAAATCCTTGGTTGG + Intergenic
1109885615 13:68539876-68539898 CTGGATTTCATTTATTTTGTTGG + Intergenic
1110855431 13:80292407-80292429 CTGGATATTATAACTTTATCAGG - Intergenic
1111000587 13:82174742-82174764 CTGGATATTAGACCTTTGTTGGG - Intergenic
1111014080 13:82354251-82354273 CTGTATGTCAGATCTTTTGTAGG + Intergenic
1111400501 13:87727944-87727966 CCAGATCTTATATCTTTTGAAGG - Intergenic
1111477207 13:88765867-88765889 TTGGAAATTATAATTTTTGTAGG + Intergenic
1111624045 13:90760608-90760630 CTGCATATTATTTGTTTTCTGGG - Intergenic
1111832157 13:93343014-93343036 CTGGATATTTTTTCTTTTGCAGG + Intronic
1112806576 13:103169524-103169546 CTGGATATTAGACCTTTTTTTGG + Intergenic
1112952912 13:105023373-105023395 CTGGATATTATATTTCCTTTAGG + Intergenic
1113827295 13:113266344-113266366 CTAGGTATTTTATCTTTTTTGGG - Intronic
1114132571 14:19809451-19809473 CTGGATATTAGACCTTTGTTTGG - Intronic
1114132630 14:19810102-19810124 CTGGATATTAGACCTTTGTTGGG - Intronic
1115725453 14:36210682-36210704 TTGGATATTATTTCTTCTTTTGG - Intergenic
1115782179 14:36782362-36782384 CTGCATATTATTTCTCTTGATGG + Intronic
1115890964 14:38028400-38028422 CTGGATATTAGACCTTTGTTGGG - Intronic
1116051631 14:39810744-39810766 GTGGATATTATACATTTTTTTGG + Intergenic
1116343846 14:43762349-43762371 ATTGAGATTATATCTTTTGTAGG + Intergenic
1117206644 14:53450291-53450313 ATCGATATTATTTCTTTTTTAGG - Intergenic
1119108748 14:71950668-71950690 CTGGATATTAGATCTTTGTCAGG - Intronic
1119596847 14:75942998-75943020 CTGGAAATTCTGTCTTTTTTTGG - Intronic
1120426405 14:84353148-84353170 CTGGATATTATACCTTTGTCAGG - Intergenic
1120723649 14:87914853-87914875 CTGGATATTAAATTATTGGTTGG + Intronic
1122085784 14:99302305-99302327 CTGGATATGGAATTTTTTGTTGG - Intergenic
1123474257 15:20578259-20578281 CTGGATTTTATTTTTTTTTTTGG - Intergenic
1123575651 15:21665211-21665233 CTGGATATTAGACCTTTGTTTGG - Intergenic
1123575716 15:21665985-21666007 CTGGATATTAGACCTTTGTTGGG - Intergenic
1123612271 15:22107684-22107706 CTGGATATTAGACCTTTGTTTGG - Intergenic
1123612336 15:22108458-22108480 CTGGATATTAGACCTTTGTTGGG - Intergenic
1123643755 15:22422095-22422117 CTGGATTTTATTTTTTTTTTGGG + Intergenic
1123874162 15:24606974-24606996 CTGGGCCTTGTATCTTTTGTGGG - Intergenic
1125987827 15:44072600-44072622 CTGGATGTTTTTGCTTTTGTAGG + Intronic
1131662615 15:94534642-94534664 CTAGATATTATAATTTTGGTGGG - Intergenic
1202984519 15_KI270727v1_random:399456-399478 CTGGATATTAGACCTTTGTTTGG - Intergenic
1202984584 15_KI270727v1_random:400230-400252 CTGGATATTAGACCTTTGTTGGG - Intergenic
1134518533 16:14906474-14906496 CTAGATAATAAATATTTTGTGGG - Intronic
1134555397 16:15159743-15159765 CTAGATAATAAATATTTTGTGGG + Intergenic
1134706204 16:16305127-16305149 CTAGATAATAAATATTTTGTGGG - Intergenic
1134961336 16:18406983-18407005 CTAGATAATAAATATTTTGTGGG + Intergenic
1134965636 16:18489586-18489608 CTAGATAATAAATATTTTGTGGG + Intronic
1135075610 16:19390823-19390845 CTAAATTTTATATTTTTTGTAGG + Intergenic
1137922613 16:52505808-52505830 CTGATTTTTATATTTTTTGTAGG - Intronic
1139172918 16:64652065-64652087 CTGGATATTAAATTCTTGGTTGG - Intergenic
1139617163 16:68104265-68104287 CTGAGTATTATTTCTTTTGGAGG + Intronic
1139912174 16:70404527-70404549 CTGGTTATTATCTGTCTTGTTGG - Intronic
1144929338 17:18846069-18846091 CTGGAAATTATATGTGTTTTTGG + Intronic
1146051316 17:29555922-29555944 CTGAATAATATATTTGTTGTAGG + Intergenic
1147616864 17:41834845-41834867 CTGGACATTATATTTACTGTTGG - Intronic
1149190356 17:54054173-54054195 CTGGTTATTATCTCTTATGCTGG + Intergenic
1149300323 17:55299409-55299431 CTGGAGAGTGTATGTTTTGTGGG - Intronic
1149364980 17:55934605-55934627 ATGGTTATTATATCTTTACTGGG - Intergenic
1149936645 17:60813502-60813524 CTGGATATTAGATATTTGTTGGG + Intronic
1150894096 17:69189411-69189433 CTGGATATTATACCTTTGTTGGG + Intronic
1153085650 18:1283491-1283513 CAGGATATTAGAACCTTTGTTGG - Intergenic
1157994198 18:52535575-52535597 ATGGAGATTATACCTTTTATTGG - Intronic
1158100570 18:53825112-53825134 CTGGATATAAAATTTTTGGTTGG - Intergenic
1159134838 18:64325673-64325695 CTGGCTATTATGTCATCTGTTGG + Intergenic
1159421223 18:68222464-68222486 CTGGAAATTATATTTTTGATAGG - Intergenic
1160127988 18:76196208-76196230 CTAGCTATTGTAACTTTTGTGGG - Intergenic
1164599952 19:29554290-29554312 CTGGATATGATATTCTGTGTTGG - Intronic
1164602663 19:29573560-29573582 CTGCATATTATATTTTTTTCAGG - Intergenic
1165605005 19:37094506-37094528 ATGGACATTATATATTTTGATGG + Intronic
1167731503 19:51260170-51260192 CTGTTTATTTTATCATTTGTAGG - Intronic
1168389101 19:55991599-55991621 CTGGTTATTAGATTTTGTGTGGG + Intergenic
926721681 2:15965848-15965870 CTGGATTTCCTGTCTTTTGTCGG + Intergenic
927387530 2:22552297-22552319 CTGGAGATTTTACCTTTTTTTGG + Intergenic
928832138 2:35500074-35500096 CTGGATCATCAATCTTTTGTTGG - Intergenic
930965483 2:57318861-57318883 CTGGATATTAGACCTTTGATGGG - Intergenic
931073424 2:58682066-58682088 TTTGATATTTTATCTTTTATTGG + Intergenic
932178616 2:69625109-69625131 GTGGGTTTTATATCTCTTGTTGG - Intronic
933319167 2:80750854-80750876 CTTGACAGTATATCTTTTGGGGG + Intergenic
933551120 2:83776846-83776868 CTGGATATTAATTCTTTATTAGG + Intergenic
933834527 2:86234594-86234616 ATGGTTTTTATATCTTTGGTAGG - Intronic
935505351 2:103893908-103893930 CTAAATTTTATATCTTTTGGTGG + Intergenic
936780337 2:116025304-116025326 CTAGACATAATATTTTTTGTTGG + Intergenic
936892007 2:117382113-117382135 TAGGATGTTATATCTTTTGTTGG - Intergenic
938264766 2:129919736-129919758 CTGGATATAATATTTTCAGTGGG - Intergenic
938752895 2:134351439-134351461 CTGGAAACTCTATCTCTTGTAGG - Intronic
939405866 2:141754899-141754921 CTGGAAATTAGATATTTTGGAGG - Intronic
939445086 2:142299622-142299644 TTGGATTTTATATCTGTTTTGGG - Intergenic
940131030 2:150382174-150382196 CCAGATATTATTTCCTTTGTTGG + Intergenic
940778972 2:157913331-157913353 CTGGATATTAGAGCTTTGTTGGG - Intronic
941242752 2:163061148-163061170 CAGCAAATTTTATCTTTTGTAGG - Intergenic
942113019 2:172700835-172700857 CTGGTTTTTATATTTTTTGGTGG - Intergenic
942257994 2:174125960-174125982 TTGGCTGTTAAATCTTTTGTGGG - Intronic
942658120 2:178235885-178235907 CTGGATATTTTATTTGATGTTGG + Intronic
942819880 2:180100276-180100298 CTGGATAGTAGACCTTTTTTGGG + Intergenic
942903503 2:181152574-181152596 ATGGAAATTATATCATTTCTGGG + Intergenic
943546610 2:189287778-189287800 CAGGATTTTATATCTTTTCTAGG - Intergenic
943629836 2:190238858-190238880 CTGGATATTAGACCTTTAGATGG + Intronic
944454887 2:199883196-199883218 CATGATATTACATCTTTTGTTGG + Intergenic
944592561 2:201231239-201231261 CTGGCTTTTACATCTTGTGTAGG - Intergenic
945024096 2:205604118-205604140 CTGGATATTATATCCTGGGTTGG + Intronic
946849976 2:223896332-223896354 CTAGATTTTTTATCTTGTGTAGG - Intronic
947044366 2:225963504-225963526 CTGGATATTTAGTCCTTTGTTGG - Intergenic
947974425 2:234352720-234352742 CTTGCTATTATATTTTTTGTAGG - Intergenic
947975153 2:234359096-234359118 CTGGATATTAGACCTTTTTCAGG + Intergenic
948719192 2:239886892-239886914 CTAGCTGTTATATCTATTGTTGG - Intergenic
1169732067 20:8797087-8797109 CTGGATATAAAATTTTGTGTTGG + Intronic
1169747399 20:8956524-8956546 CTGGATATTATGTCTTTTAAAGG + Intronic
1170632883 20:18080388-18080410 CTGGATATAGTATCTAGTGTAGG + Intergenic
1173464525 20:43270503-43270525 CTGGAGTTTACATTTTTTGTGGG - Intergenic
1173728170 20:45311355-45311377 CTGGATATATTATATTTTGAAGG + Intronic
1173787418 20:45804546-45804568 CTGCATTTTATTTCTTCTGTAGG - Intronic
1173992470 20:47313990-47314012 GTGTATATTAAATCTTTTTTTGG - Intronic
1175352394 20:58333750-58333772 CTCGATTTTATGTCTTGTGTTGG - Intronic
1175634883 20:60572944-60572966 ATGTAAATTATATCTTTTGGGGG + Intergenic
1179131453 21:38641068-38641090 CTGGATTTTATGCCTTTTCTGGG - Intronic
1179352743 21:40628585-40628607 CTAGATATTTTAGGTTTTGTGGG - Intronic
1184691344 22:46118690-46118712 CTGGATATGGTATCTTTACTCGG - Intergenic
949296111 3:2525396-2525418 CTGGATATTGTTTATATTGTCGG + Intronic
949330557 3:2917133-2917155 CTGGTTTTTATATTTTTTGGTGG - Intronic
949593116 3:5514374-5514396 CTGGATATTAGATCTTTGTCAGG - Intergenic
950578544 3:13847482-13847504 CTGGAGATTCTCTCTTCTGTGGG - Intronic
951069011 3:18303729-18303751 CTGGAAAATATATCTTTAATAGG - Intronic
951233735 3:20210649-20210671 ATGTATATTATATATATTGTGGG + Intergenic
951677222 3:25255243-25255265 CTGGATATTTAATCTGTTTTTGG + Intronic
951796803 3:26548306-26548328 ATGGATATTTTATCTTCTGTGGG - Intergenic
953151007 3:40324565-40324587 CTGGATATTAGACCTTTGCTGGG - Intergenic
957460951 3:80519876-80519898 GTGGTTATTATATATATTGTAGG - Intergenic
957763965 3:84596762-84596784 CTGGATATTAGTTCTTTGTTAGG - Intergenic
958064581 3:88527273-88527295 CTGGATATGAAGTCCTTTGTTGG + Intergenic
959082843 3:101820701-101820723 ATTGAGATAATATCTTTTGTGGG + Intronic
959128584 3:102322086-102322108 CTGGGTATAAAATTTTTTGTTGG + Intronic
959166182 3:102781291-102781313 CTGGATATTAGACCTTTGTTAGG + Intergenic
959752201 3:109851239-109851261 CTGGGTATGATATTTTTGGTTGG - Intergenic
960012763 3:112851151-112851173 CTGGATATGAAATCATTGGTTGG - Intergenic
961964089 3:130884371-130884393 CTTGATATTATTTCATTTTTGGG + Intronic
962218348 3:133542062-133542084 CTGTATAAGATATCTCTTGTTGG - Intergenic
962796170 3:138851303-138851325 CAGACTATTTTATCTTTTGTAGG + Intergenic
964492778 3:157254661-157254683 CTGGATATTAGACCTTTGTTGGG - Intergenic
964826470 3:160833664-160833686 CTGGATATTAGACCTTTGTTAGG + Intronic
965289505 3:166861263-166861285 CTGGATTTTAACTCTTATGTAGG - Intergenic
966070007 3:175864419-175864441 CTGTATATTTTTTCTTTTTTTGG - Intergenic
966245157 3:177800173-177800195 CTGGATATTAGACCTTTGTTGGG - Intergenic
966305209 3:178524999-178525021 ATGGTTACTATATCATTTGTAGG - Intronic
966998261 3:185306670-185306692 CTGGATATTAGACCTTTTGGTGG + Intronic
968218088 3:196911312-196911334 CTGGATATTAGATCTTTGTCAGG - Intronic
970783955 4:19773454-19773476 TTGCATAATATATATTTTGTAGG - Intergenic
971493339 4:27237573-27237595 TTGGATTTTCTACCTTTTGTGGG + Intergenic
971526255 4:27622101-27622123 CTGGATATTAAACCTTTGTTGGG - Intergenic
972027976 4:34411390-34411412 CTGGATATAATATTCTTGGTTGG + Intergenic
972906647 4:43757215-43757237 CTTGATCTCATACCTTTTGTTGG + Intergenic
973804945 4:54516635-54516657 CTGGTTATCATGTCTTTTGTCGG + Intergenic
974217736 4:58874338-58874360 CTGGATATTTAGTCCTTTGTTGG - Intergenic
974431415 4:61801676-61801698 CTTGATATTATATCCTCTTTTGG - Intronic
974496189 4:62631500-62631522 CAGGATATTATATTCTTTGTTGG - Intergenic
974621596 4:64362574-64362596 CTGGATATTAAATTCTTGGTTGG - Intronic
975351133 4:73348472-73348494 CTGGATATTAGACCCTTTGTTGG - Intergenic
975956166 4:79841805-79841827 CTGCCTATTCTATCTTTTATTGG + Intergenic
977125461 4:93160949-93160971 CTGGACATTTTATTTTTTCTTGG - Intronic
977440226 4:97056671-97056693 CTGGATATGAAATTCTTTGTTGG + Intergenic
977482495 4:97595638-97595660 CTGGATATTAAATTCTTGGTTGG - Intronic
977735258 4:100407491-100407513 CTGGATATGAAATTCTTTGTTGG + Intronic
979127894 4:116999304-116999326 CTGGAGACTATCTTTTTTGTTGG - Intergenic
979662696 4:123276371-123276393 CTGGATATTATATCTTTTGTGGG + Intronic
979929646 4:126615104-126615126 CAGGATATTTTATCTTGGGTTGG + Intergenic
980016968 4:127660876-127660898 AGGGATATTATATGTTTTATAGG - Intronic
980694662 4:136339101-136339123 CTGGATATTACATTTTTGGTTGG - Intergenic
981276551 4:142904871-142904893 CTAGATACTTTATTTTTTGTAGG + Intergenic
982519937 4:156403211-156403233 CTGGATATAAAATTTTTGGTTGG - Intergenic
983474591 4:168198066-168198088 CAGGATATAAAATCTTTGGTTGG - Intergenic
983756870 4:171349782-171349804 CTGGCTATTATTTTTTTTATTGG - Intergenic
983758176 4:171368650-171368672 ATGGATCTTTTATTTTTTGTGGG + Intergenic
984096286 4:175438960-175438982 CAGGATATTTTATTTTTTTTAGG - Intergenic
984693840 4:182758974-182758996 CTTGAGATTAAAGCTTTTGTAGG + Intronic
984913253 4:184695978-184696000 TTGGATATTGTATTTTATGTTGG - Intronic
984991171 4:185383120-185383142 ATGTATATTAAATCTTTTATAGG + Intronic
985054466 4:186024275-186024297 CTGGATATTAGTTTATTTGTTGG - Intergenic
986229608 5:5850959-5850981 CTGGATATAAAATATTTGGTTGG - Intergenic
986778553 5:11042971-11042993 AAGGATACTATCTCTTTTGTTGG - Intronic
986878009 5:12134065-12134087 CTGGACATTAAATTTTTGGTTGG - Intergenic
987159820 5:15130826-15130848 CTGGATATGAAATTCTTTGTTGG + Intergenic
987585289 5:19846884-19846906 CTGGATATAATATTTTTTGTCGG + Intronic
987762136 5:22178760-22178782 ATGTCTATTATATCTTTTCTTGG - Intronic
987852804 5:23378831-23378853 CTGGATATTAATTCATTTTTGGG - Intergenic
988152969 5:27411530-27411552 CTTCAAATTATATCATTTGTGGG - Intergenic
988185007 5:27848607-27848629 CTGGATATTATTTCTTTGTTGGG + Intergenic
988747582 5:34156686-34156708 CTAGATATTATATGTTGTGGGGG + Intergenic
988944542 5:36183162-36183184 CTGGATTTTAACTCTTATGTAGG - Exonic
989752297 5:44910279-44910301 CTAGATTTAATATTTTTTGTTGG - Intergenic
990651398 5:57903987-57904009 CTGGAAAATATTTCTGTTGTAGG + Intergenic
991357643 5:65786114-65786136 CTGTATCTTATATCTTCTTTAGG + Intronic
991504523 5:67310023-67310045 CTGGATATTAAATTCTTGGTTGG - Intergenic
991896919 5:71412224-71412246 ATGTCTATTATATCTTTTCTTGG - Intergenic
992056287 5:72994791-72994813 AATGAGATTATATCTTTTGTGGG + Intronic
992645333 5:78806527-78806549 CTGGATTTTAAAGCATTTGTAGG + Intronic
992697926 5:79309448-79309470 CAGGATAATATATATTGTGTGGG - Intronic
993934552 5:93985587-93985609 CTGGATTTTGTATTTTTTGGTGG + Intronic
994129537 5:96209586-96209608 CTGGATATGAAATTTTTTATTGG + Intergenic
994303430 5:98174125-98174147 CTTGATAGTACATCTTTTATTGG - Intergenic
994578435 5:101610315-101610337 CTTGTCCTTATATCTTTTGTGGG - Intergenic
995337544 5:111017846-111017868 CTGAATATTATATGTATTGTGGG + Intergenic
995696831 5:114888103-114888125 CTGGATATTAGACCTTTGTTGGG - Intergenic
996316597 5:122167325-122167347 CAGGACATTAAATTTTTTGTAGG - Intronic
996598399 5:125231576-125231598 CTGGCTATTAAGACTTTTGTTGG + Intergenic
996676157 5:126177077-126177099 CTGGATATTAGATCTTTGTCAGG - Intergenic
996908392 5:128629222-128629244 ATAGATATGATATATTTTGTAGG + Intronic
996999048 5:129736825-129736847 CTGGGAATTATATCTTTAATAGG + Intronic
997128272 5:131250684-131250706 CTTTTTATTATATGTTTTGTGGG - Intronic
999631209 5:153573219-153573241 CTGGCTTTTATATTTTATGTTGG + Intronic
999807799 5:155100001-155100023 CTGCATAATATTTCTTTTGTGGG + Intergenic
999880347 5:155856260-155856282 CTGTATTTTATCTCTTGTGTTGG - Intergenic
1000441300 5:161266708-161266730 CTGTATATTAGATCTGTAGTTGG - Intergenic
1000513334 5:162209936-162209958 CTGTATATTCTCTTTTTTGTGGG - Intergenic
1000895873 5:166854787-166854809 CTGGATATTATATTTTGATTGGG - Intergenic
1001985307 5:176069564-176069586 CTGGATCTTAACTCATTTGTTGG + Intronic
1002231564 5:177768566-177768588 CTGGATCTTAACTCATTTGTTGG - Intronic
1002263777 5:178015182-178015204 CTGGATCTTAACTCATTTGTTGG + Intronic
1003007471 6:2395015-2395037 CTGGTTATTCTTGCTTTTGTGGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003450338 6:6225219-6225241 CTTGAGATTTTATCTTTTGTAGG - Intronic
1003771310 6:9305245-9305267 CTCTAAATTATATCTTTAGTTGG + Intergenic
1004067408 6:12262280-12262302 CTGCATTTTCTGTCTTTTGTTGG - Intergenic
1005066873 6:21826843-21826865 CTTGATTTTATATCTTTTTCTGG + Intergenic
1005387714 6:25301984-25302006 CTGGGTACTATTTCTTTTGAGGG + Intronic
1005545085 6:26859049-26859071 CTAGATATTATATGTTGTGGGGG + Intergenic
1006885947 6:37382429-37382451 GTGAATATTATGTCTTGTGTGGG - Intronic
1007475876 6:42119654-42119676 CTTGTTTTTATATTTTTTGTGGG + Intronic
1008046713 6:46858847-46858869 CTGGATATTATTTCTTATGTTGG - Exonic
1008258082 6:49329373-49329395 CTGGATATATTATCTGTTGATGG + Intergenic
1008551095 6:52631508-52631530 CTGGATATTATATATCATTTTGG + Intergenic
1008716266 6:54293882-54293904 CTGGATATGACATTATTTGTTGG + Intergenic
1009015876 6:57900663-57900685 CTAGATATTATATGTTGTGGGGG + Intergenic
1009043027 6:58204238-58204260 CTGGATATTGTATCCTTGGCTGG + Intergenic
1010158814 6:72827336-72827358 CTGTATATTATACCTCTTGTTGG - Intronic
1010613107 6:77980350-77980372 CTGGATATGAAATTTTGTGTTGG + Intergenic
1011241245 6:85273406-85273428 CTGGATAATATTTCCCTTGTTGG + Intergenic
1012042638 6:94229244-94229266 CTGGATATTATCATTTATGTTGG + Intergenic
1012760621 6:103295703-103295725 TTTAATTTTATATCTTTTGTTGG - Intergenic
1013847761 6:114475028-114475050 CTGGATATTATCTATGTTGTGGG - Intergenic
1013939003 6:115637692-115637714 CTTTATTTTATATCTTTTCTGGG - Intergenic
1014037711 6:116786786-116786808 CTGGATATTATACTTTATTTAGG + Intergenic
1014566424 6:122954941-122954963 CTGGATATGAAATCCTTGGTTGG - Intergenic
1014975047 6:127870021-127870043 CTGGGTCTTACATCTTTTGAAGG + Intronic
1016103349 6:140130273-140130295 CTGGATATAGTATCTTTGGGTGG - Intergenic
1016480269 6:144473183-144473205 CTGGATTTTATATATATAGTAGG + Intronic
1016822174 6:148357074-148357096 CTGGATATTAGTTCTTTGTTGGG + Intronic
1017181900 6:151562612-151562634 TTAGATATTCTATCTTCTGTAGG + Intronic
1018132197 6:160742539-160742561 CTGGATATTAGACCTTTTTCAGG + Intronic
1019430013 7:994603-994625 CCGGATTTTTTATTTTTTGTTGG + Intergenic
1020607659 7:10358833-10358855 CTGGATATGAAATTTTTGGTTGG + Intergenic
1020672603 7:11136410-11136432 CTGGTAATTATATTATTTGTGGG - Intronic
1020692671 7:11376096-11376118 TTGGATAATTTATCTTTTGTAGG - Intronic
1020995854 7:15263180-15263202 CTGGATATTAAATCTTTGTCAGG - Intronic
1021063757 7:16146224-16146246 CTGCATATAATATTTTTGGTTGG - Intronic
1023510448 7:40946710-40946732 CTGGATATAAAATTTTTGGTTGG + Intergenic
1024406349 7:48985958-48985980 CTGGATATTAGATCTTTTTCAGG + Intergenic
1025018953 7:55465716-55465738 CTGGAGATTAAATCATTTGCTGG + Intronic
1025266155 7:57459386-57459408 CAAAATATTATATTTTTTGTTGG - Intronic
1028019491 7:85751912-85751934 CTGGATATGAAATTCTTTGTTGG - Intergenic
1028378411 7:90172288-90172310 CTGCATATTATGTCTTTTATAGG + Intronic
1028447325 7:90940618-90940640 CTGATTTTTATATTTTTTGTAGG - Intronic
1030572027 7:111238639-111238661 ATGGATATTTTACCTTTTGAGGG - Intronic
1031093553 7:117391213-117391235 CTGGATATTTAGTCCTTTGTTGG + Intronic
1031756809 7:125654538-125654560 CTGGATAGTATATCTTTCTGAGG + Intergenic
1033528051 7:142235947-142235969 CTGGATATGAAATCCTTGGTTGG - Intergenic
1037444827 8:18954947-18954969 CTTGATGTTATCTCTTTTTTTGG - Intronic
1039104089 8:33971491-33971513 CTGGATTTTTTATTTTTTGGTGG + Intergenic
1040748361 8:50673789-50673811 TTCAATATTATATCTGTTGTGGG + Intronic
1041064814 8:54072486-54072508 CTGGATATTAGACCTTTGTTGGG - Intronic
1041152878 8:54954725-54954747 CTGGATATGATTTTTTTTCTTGG + Intergenic
1041220524 8:55646943-55646965 CTGGATATGAAATCCTTGGTTGG + Intergenic
1041899981 8:62971469-62971491 CTGGTTTTTGTATTTTTTGTAGG - Intronic
1043243072 8:77961170-77961192 CTGGATGTCATATCTTATGGTGG - Intergenic
1043697555 8:83239870-83239892 CTGGAAAGTATATCTTTTAATGG + Intergenic
1044175378 8:89114294-89114316 CTGGATATTAGATCTTTTTCAGG - Intergenic
1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG + Intergenic
1045420727 8:102012255-102012277 TTGGATATTATTACATTTGTAGG - Intronic
1045586702 8:103545746-103545768 CTGGATATGAAATTTTTTATTGG - Intronic
1045731810 8:105251001-105251023 ATGGATATTTTATAGTTTGTTGG + Intronic
1046426146 8:114052866-114052888 TTGGATATTTTTTTTTTTGTCGG - Intergenic
1046959934 8:120100734-120100756 CTGGATATTAAATTTTTGGTTGG + Intronic
1048737933 8:137522257-137522279 CTGGCTACTTTAACTTTTGTTGG - Intergenic
1048828173 8:138449870-138449892 CTAGATGTTATATCTTCTATTGG + Intronic
1049037781 8:140090167-140090189 CTGGCTATTATAACATATGTAGG + Intronic
1050282450 9:4065099-4065121 CTGGCTATTTTTTCTTCTGTCGG + Intronic
1050870261 9:10558988-10559010 TTCTATATTATATATTTTGTTGG + Intronic
1050966493 9:11810499-11810521 CTGGATATTAAATTCTTGGTTGG + Intergenic
1051619218 9:19034531-19034553 GTGAATATTTTAGCTTTTGTGGG - Intronic
1051914686 9:22194146-22194168 CTGGATATTAGACCTTTTTCAGG + Intergenic
1052224712 9:26071691-26071713 CTGAGACTTATATCTTTTGTGGG + Intergenic
1052694268 9:31855638-31855660 CTGGATATAAAATTTTTGGTTGG - Intergenic
1052909406 9:33866830-33866852 GTGCATATTAAATCATTTGTTGG + Intronic
1053245151 9:36528777-36528799 CTGGATATCATGTCTGTTTTGGG - Intergenic
1053901076 9:42796046-42796068 CTGGATATTATTTCTTACGTTGG + Intergenic
1054260570 9:62861518-62861540 CTGGATATTATTTCTTATGTTGG - Intergenic
1055632642 9:78238999-78239021 CTGGTTTTTTTATTTTTTGTAGG - Intronic
1055815606 9:80201563-80201585 TTGGATAGTATATCTTTTAAAGG - Intergenic
1056482303 9:87017826-87017848 CTGGGTATTCTATCTTCTTTAGG + Intergenic
1057129494 9:92643131-92643153 CTGGATATTATAACTTCTGAAGG - Intronic
1058554449 9:106151936-106151958 CTGGATATTAGACCTTTGTTAGG - Intergenic
1059839997 9:118204059-118204081 CTGGATATAAAATTCTTTGTTGG + Intergenic
1060336777 9:122731410-122731432 CTGGATATTAAATTCTTGGTTGG - Intergenic
1060437968 9:123611702-123611724 CTGTATATTAACTCATTTGTTGG - Intronic
1061698520 9:132396831-132396853 CTGGTTTTTATATTTTTAGTAGG + Intronic
1185882052 X:3750199-3750221 GTGGATAATATACCTTTTTTGGG - Intergenic
1187793442 X:22976163-22976185 CTGGATATTAGACCTTTGTTGGG - Intergenic
1187820278 X:23280077-23280099 AGGGAGATTATATCTTTTGCAGG + Intergenic
1188941674 X:36245592-36245614 CTGGATATTTTAACTTTTTGTGG - Intronic
1190973943 X:55380986-55381008 CTGGATATGAAATTTTTGGTTGG - Intergenic
1191238615 X:58159427-58159449 CTGGATATTTGATTTTTTATAGG - Intergenic
1192346570 X:70313653-70313675 CTGCATATTTTTTCTTATGTTGG + Intronic
1192607656 X:72536071-72536093 CTTGTTATGATATCTTCTGTGGG + Intronic
1192863548 X:75106209-75106231 CTGGATATTAGTTCTTTATTGGG - Intronic
1192985032 X:76389120-76389142 TTGGATATTAGTTTTTTTGTTGG + Intergenic
1193020993 X:76793023-76793045 CTGGATATTCTCACTTATGTTGG - Intergenic
1193032109 X:76909474-76909496 CTGGATATGAAATTTTTGGTTGG - Intergenic
1193170019 X:78324707-78324729 CTGACTAATCTATCTTTTGTAGG + Intronic
1193357928 X:80543843-80543865 CTGGATATGAAATTTTTGGTTGG - Intergenic
1193427557 X:81357759-81357781 CTGGATATTAGACCTTTGTTGGG + Intergenic
1193646644 X:84078574-84078596 CTGGATAATATTTCTTTTTATGG - Intronic
1194157634 X:90412527-90412549 CTTGATATTCTTTTTTTTGTTGG + Intergenic
1194243369 X:91479265-91479287 CTGGACATTAAATTTTTGGTTGG + Intergenic
1194671048 X:96733162-96733184 GTGGAGCTTATATTTTTTGTTGG + Intronic
1194773420 X:97932771-97932793 TTGGTTATTATATTTTTTCTGGG + Intergenic
1195509345 X:105696546-105696568 CTCGATTTTATTACTTTTGTGGG - Intronic
1195855283 X:109325119-109325141 TTGGATATTCTCTCTTTTCTTGG + Intergenic
1196383905 X:115127000-115127022 CTGGATGGCATATCTTTAGTAGG - Intronic
1197094104 X:122573349-122573371 CTGGATATGAAATTCTTTGTTGG - Intergenic
1198662863 X:138989915-138989937 GTGGATATTATAGCTTATTTGGG - Intronic
1198714840 X:139546237-139546259 AAGGAGATTATGTCTTTTGTGGG - Intronic
1201567899 Y:15385613-15385635 CAGGATCTTATATCTTTATTGGG - Intergenic
1202033736 Y:20608605-20608627 CTGGATATTAAATTCTTGGTTGG + Intergenic
1202041367 Y:20687986-20688008 CTGGATATCATATCCTTGGGTGG + Intergenic
1202069392 Y:20974990-20975012 CTGGATATTAGACCTTTTTAAGG - Intergenic