ID: 979662944

View in Genome Browser
Species Human (GRCh38)
Location 4:123279291-123279313
Sequence CTGTAATCCCAGCTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 3, 1: 11, 2: 26, 3: 87, 4: 531}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979662933_979662944 26 Left 979662933 4:123279242-123279264 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG 0: 3
1: 11
2: 26
3: 87
4: 531
979662940_979662944 -3 Left 979662940 4:123279271-123279293 CCGGGCGTGGTGGCAGGCACCTG 0: 2562
1: 16195
2: 47269
3: 85378
4: 123123
Right 979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG 0: 3
1: 11
2: 26
3: 87
4: 531
979662934_979662944 25 Left 979662934 4:123279243-123279265 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG 0: 3
1: 11
2: 26
3: 87
4: 531
979662932_979662944 27 Left 979662932 4:123279241-123279263 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG 0: 3
1: 11
2: 26
3: 87
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979662944 Original CRISPR CTGTAATCCCAGCTGAGGCT GGG Intronic
900953111 1:5870169-5870191 CTGAAATGCAAGCTGAGCCTGGG + Intronic
901008271 1:6182190-6182212 CTGTAGTCCCAGCTGCTACTGGG - Intronic
901038872 1:6352283-6352305 AAGGAATCCCAGCTGAGGCTGGG - Intronic
901519346 1:9770869-9770891 CTGTAATCCCAGCTAATGGGAGG + Intronic
901568566 1:10139976-10139998 CTGTAATCCCAGCAAGGCCTAGG - Intronic
901575290 1:10195887-10195909 CTGTAGTCCCAGCTGCTTCTTGG - Intergenic
901900261 1:12355166-12355188 CTGTAACAACAGCTGAGTCTTGG - Intronic
902201715 1:14838439-14838461 CTTTCTTCCCAGCTGAGGTTTGG - Intronic
902816733 1:18920729-18920751 CTGTCTCCCCACCTGAGGCTTGG - Intronic
903040145 1:20523326-20523348 ATAGAATCCCAGCTGAGGCCAGG - Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903403536 1:23076837-23076859 CTGTAATCCCAGCAGTTACTTGG + Intronic
903837047 1:26211201-26211223 CTGTAGTTCCAGCGGAGGCCTGG + Intergenic
903926219 1:26832615-26832637 TTCTACTCCCAGCTGAAGCTGGG + Intronic
904023106 1:27483511-27483533 CTGTAATCCCAGCTGCTACTAGG + Intronic
905484248 1:38284420-38284442 CTTCAATTCCAACTGAGGCTGGG - Intergenic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905590421 1:39158622-39158644 CAGTAATCCCAGTGGAGCCTGGG + Intronic
905659569 1:39711085-39711107 CTGTAATCCCAGCTCAAGATGGG + Intronic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
906366906 1:45218197-45218219 CTGTAATTCCAGCTGCTACTTGG - Intronic
906502299 1:46350271-46350293 CTGTAATCCCAGCACAAGCTAGG + Intronic
907138030 1:52157661-52157683 CTGTAATCCCAGCACACTCTGGG - Intronic
907162616 1:52382272-52382294 CTATAATCCCAGTTTAGGCCGGG - Intronic
907181895 1:52578117-52578139 CTGTAGTCTCAGCTGAACCTGGG + Intergenic
908189421 1:61686538-61686560 CTGTAATCCCAGCTACTACTAGG + Intronic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
908769454 1:67583003-67583025 CTGCAATCCCAGCAGTGGGTAGG - Intergenic
908998975 1:70195756-70195778 CTGTAAGTCCAGCTGCTGCTCGG - Intronic
909010715 1:70331698-70331720 CTGTAATCCCAGCTACTACTAGG + Intronic
909572961 1:77138502-77138524 CTGTGGTCTCATCTGAGGCTTGG - Intronic
911814944 1:102336530-102336552 CTGTATTTCCAGCTGAGGCAGGG + Intergenic
912515265 1:110212836-110212858 CTCTCACCCCAGCTGAGGCCAGG - Intronic
912730207 1:112095528-112095550 CGGTTATCCCATCTGAGCCTTGG + Intergenic
913272805 1:117110542-117110564 CTGTAATCTCAGCTTACTCTCGG + Intergenic
913477384 1:119251493-119251515 CTGTAATCCCAGCCGAGGCAGGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915226063 1:154412376-154412398 CAGTAATCCCAGCTGAGGCCAGG - Intronic
915413551 1:155722143-155722165 CTGTAATCCCAGCTGCACTTTGG + Intronic
915436223 1:155908683-155908705 CTGTAATCCCAGCTACTGCGGGG - Intronic
915483666 1:156204939-156204961 CTGCCATCCCAGCTGAGACTTGG + Intronic
916093097 1:161324353-161324375 CTATAATCCCAGCCGAGGCAGGG - Intronic
916114941 1:161478643-161478665 TTGTAAGACCATCTGAGGCTTGG - Intergenic
916233788 1:162565101-162565123 CTGTAATCCCAGCACAGGCCTGG - Intronic
916527217 1:165621922-165621944 CTGTAATCCCAGCATAGGCTAGG + Intergenic
916679420 1:167090431-167090453 CTGCCAATCCAGCTGAGGCTGGG - Exonic
917565034 1:176204800-176204822 CTGTAATCCCAGCTACTACTCGG + Intronic
918545644 1:185680706-185680728 CCGGAATCCCAGCTGAGCCAAGG + Intergenic
918659425 1:187071667-187071689 CTGTAATCCCAGCAGCACCTTGG - Intergenic
918772822 1:188585603-188585625 CTGTAATCCCAGCTGGGCTGTGG - Intergenic
919714944 1:200766376-200766398 CTGTAATCCCAGCATAGCCCAGG - Intronic
919983027 1:202654117-202654139 CAGTAAGCTCAGCTGTGGCTGGG - Intronic
920878088 1:209855828-209855850 CTGTTCTCCCAGCTGAGCCAAGG + Exonic
922173689 1:223178428-223178450 CTGTAAGCCAAGGGGAGGCTGGG + Intergenic
922672215 1:227519175-227519197 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
922743896 1:228032259-228032281 CTGTCCTCCAAGCTGAGCCTTGG + Intronic
923489189 1:234468329-234468351 CTGTAATCCCAGCTACTGGTGGG + Intronic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
924822169 1:247503801-247503823 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
1062980614 10:1719084-1719106 CTGTAATCCCAGCTACTACTTGG - Intronic
1063027217 10:2192241-2192263 CTGTAATCCCAGCTGTGATTGGG - Intergenic
1063177171 10:3561929-3561951 CTGTAATCCCAGCTACGTCAGGG - Intergenic
1063337845 10:5233943-5233965 CTGTATTCCCAGCTAAATCTAGG - Intergenic
1063642332 10:7842280-7842302 CTGTGATCCCAGCTGGTGGTAGG - Intronic
1064428300 10:15249355-15249377 CTATAATCCCAGCACAGGCCTGG - Intronic
1064635993 10:17367460-17367482 CTGTAATTCAAGATGAGACTTGG + Intronic
1064658858 10:17585104-17585126 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1065350216 10:24788846-24788868 CTGTAATCCCAGCTAATCCCAGG - Intergenic
1065622791 10:27600291-27600313 CTGTAATCCCAGCCAAGGCCGGG - Intergenic
1066639980 10:37546206-37546228 GTGTAATCACAGCTGATGCCAGG - Intergenic
1067117214 10:43444825-43444847 CTGTAATCCCAGCACTGCCTGGG - Intronic
1068085442 10:52368230-52368252 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1068571937 10:58639518-58639540 CTGTAATCCCAGCTACTACTTGG - Intronic
1069372162 10:67759887-67759909 CTGCAATCTCATCTGAGGTTTGG - Intergenic
1069673478 10:70230846-70230868 CTGTACTCCCAGGCTAGGCTGGG + Intronic
1070119267 10:73559804-73559826 CTGGAATCCCAGCAGAGTTTGGG + Intronic
1072088694 10:92105836-92105858 CTGTAATCCCAGCTACTGGTGGG - Intronic
1072104729 10:92263196-92263218 CTGTAATCCCAGCTACTCCTGGG - Intronic
1072254490 10:93608287-93608309 CTGTAGTCTCAGCTGAGACTGGG - Intergenic
1072343967 10:94484367-94484389 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1072414037 10:95231988-95232010 TTGTAATCCCAGCCAAGGCAGGG - Intergenic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072470635 10:95709896-95709918 CTGTAATCCCAGCTACTGGTGGG - Intergenic
1073087462 10:100902375-100902397 CTATAGTCCCAGCTGAGGTAGGG - Intergenic
1073908116 10:108308172-108308194 CTGTAGTCCCACGGGAGGCTGGG - Intergenic
1074202970 10:111256236-111256258 CTGTAATCCCAGCTACTACTCGG + Intergenic
1076020031 10:127065129-127065151 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1077068467 11:655952-655974 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
1077629230 11:3799413-3799435 CTATAATCCCAGCTGCTTCTCGG + Intronic
1078723445 11:13905294-13905316 CTCTAAGCCTAGCTGGGGCTTGG - Intergenic
1078763274 11:14269188-14269210 CTGTAATCCCAGCAGACTTTGGG + Intergenic
1080197002 11:29623114-29623136 CTGTAATTATAGCTGAGTCTTGG + Intergenic
1080702002 11:34651811-34651833 CTGTCATCACATCTGAGGCTGGG + Intronic
1081295955 11:41389609-41389631 CTGTTATCCTAGATTAGGCTTGG - Intronic
1081469462 11:43356501-43356523 CTGCAATCTCATCTGAGGCTTGG - Intergenic
1081566310 11:44263330-44263352 GTGTACTCCCAGCTGAGGTGAGG + Exonic
1081687017 11:45049856-45049878 CTGTACTCCAGGCTGAGGCTTGG - Intergenic
1082018607 11:47512107-47512129 CTGTAATCCTAGCTTACTCTGGG - Intronic
1083864744 11:65447521-65447543 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1084542219 11:69794126-69794148 CTGTAATCCCAGCAGATGGGAGG + Intergenic
1085065836 11:73494875-73494897 CTGTAATCCCAGCTACTACTTGG + Intronic
1087020044 11:93592901-93592923 CTGTAATCCCAGCTACTACTTGG + Intergenic
1087634090 11:100683892-100683914 CTGTAATCCCAGCAGGTACTAGG - Intergenic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1087783817 11:102331761-102331783 CTGTAATCCCAGCTAAGGGAAGG - Intronic
1087913526 11:103780925-103780947 CTGTAGTCCCAGCTAGGGCGTGG - Intergenic
1088201468 11:107339788-107339810 CTGTAATCCCAGCTGTTGTGGGG - Intronic
1088249814 11:107852747-107852769 CTGTAATCCCAGCTACTACTAGG + Intronic
1088446902 11:109940530-109940552 CTGTAATCTCAGCTGCTACTTGG + Intergenic
1088866739 11:113854657-113854679 CTGTAATCCCAGCGGACTTTGGG - Intronic
1088979586 11:114850096-114850118 ATGTGATGCAAGCTGAGGCTTGG - Intergenic
1089387194 11:118076144-118076166 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1089487392 11:118857533-118857555 CTGTAGTCCCAGCTTAAGCCTGG - Intergenic
1090120524 11:124022549-124022571 CTGCAATCTCATCTGAGGCTGGG - Intergenic
1090121099 11:124029203-124029225 CTGCAATCTCATCTGAGGTTGGG - Intergenic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090996488 11:131870509-131870531 CTGGAATCCAACCTTAGGCTAGG - Intronic
1091600400 12:1914499-1914521 CTGTGATGCCAGCGGAGACTTGG - Intronic
1092493942 12:8973016-8973038 CTGTAATCCCAGCTGGGCTGAGG + Intronic
1093084151 12:14848119-14848141 CTGTGATCCCAGATAAGTCTGGG + Intronic
1093180363 12:15960513-15960535 CTGTAATCCCAGCTGCTGGGAGG + Intronic
1094807170 12:34105738-34105760 CAATCATCCCAGCTGAGTCTGGG - Intergenic
1094812387 12:34151283-34151305 CTGTGTTCTCAGCTGAAGCTGGG - Intergenic
1095460286 12:42436363-42436385 CAGTAATGCCAGCTGAGGCCAGG - Intronic
1095811679 12:46378667-46378689 CTGTAATCCCAGCTGTAGGGAGG - Intergenic
1096300560 12:50423875-50423897 CTGTAATCCCAGCTACTACTCGG - Intronic
1096432346 12:51557083-51557105 CTGTAATCCCAGCTGCTTGTGGG + Intergenic
1097024672 12:56046054-56046076 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1097568634 12:61302833-61302855 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1097782701 12:63726483-63726505 CTGTAATCCCAGCTACTACTCGG + Intergenic
1098898534 12:76089201-76089223 CTGTAATCCCAGCTACTACTTGG - Intergenic
1098970424 12:76849184-76849206 CTGTAATCCCAGCTGCTGGTGGG + Intronic
1100845110 12:98650237-98650259 TTGTAATCCCAGCTGAGGCGTGG + Intronic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1102311299 12:111846619-111846641 CTGTAATCCCAGCTACTACTCGG - Intronic
1102312880 12:111860859-111860881 CTGTAATCCCAGCACAGGCATGG + Intronic
1102417174 12:112773957-112773979 CTGTAATCCCAGCTACTACTTGG + Intronic
1102630784 12:114277421-114277443 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1102684842 12:114716766-114716788 CTGTAATCCCAGCTCCTCCTGGG - Intergenic
1103425167 12:120827672-120827694 TAATGATCCCAGCTGAGGCTGGG - Intronic
1103473703 12:121202457-121202479 CTGTAATCCCAGCTACTACTTGG + Intergenic
1103593065 12:122005981-122006003 CTGTAATCCCAGCTGTATCCTGG - Intergenic
1104702957 12:130921146-130921168 CAGGAATCACAGCTGAGGCCAGG + Intergenic
1104865677 12:131952040-131952062 CTGTAATCCCAGCAAAGGGGAGG - Intronic
1105386731 13:19937251-19937273 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1107334685 13:39342227-39342249 CTGTAATCCCAGCCGAGGTGGGG - Intergenic
1110199987 13:72838676-72838698 CTGTAACAACAGCTGAGTCTGGG - Intronic
1110696020 13:78490551-78490573 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1110720815 13:78759315-78759337 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1111124962 13:83903289-83903311 CTGTAATCCCAGCTGCTGGGAGG - Intergenic
1112306629 13:98280283-98280305 CTGGAAAACCAGCTGATGCTGGG - Intronic
1113471758 13:110551962-110551984 CTGTAGTCCCAGCTGAGAGGTGG + Intronic
1113968918 13:114173496-114173518 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1115433306 14:33346107-33346129 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1115492239 14:33968624-33968646 CTGTAATCCCAGCAGTTTCTGGG - Intronic
1116159384 14:41249488-41249510 CTGTAATCCCAGCTGCTACTTGG + Intergenic
1116810785 14:49537957-49537979 CTGTAGTCCCAGCTCATGGTAGG - Intergenic
1118193769 14:63605580-63605602 CTGTAATCCCAGCTGCTTCGGGG - Intronic
1118758470 14:68862916-68862938 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1119352201 14:73975276-73975298 ATGTGATCCCAGTTGGGGCTAGG - Intronic
1119457543 14:74769407-74769429 CTGTAATCCCAGCTACTCCTGGG - Intronic
1119953185 14:78767139-78767161 TTGTGATCTCATCTGAGGCTTGG + Intronic
1120583052 14:86278036-86278058 CTGTAATCCCAGCTATTGCAGGG + Intergenic
1121054350 14:90840577-90840599 TTATAATCACAGCAGAGGCTGGG - Intergenic
1121341100 14:93105645-93105667 CTGTAATCCCAGCTACTACTCGG - Intronic
1121343386 14:93117898-93117920 CTGAAAGACCAGTTGAGGCTGGG + Intergenic
1121397330 14:93637578-93637600 CTGTAATCCCAGCTACTCCTCGG - Intronic
1122260533 14:100517719-100517741 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1122557178 14:102587372-102587394 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1122660820 14:103293760-103293782 GTGTCAGCACAGCTGAGGCTGGG - Intergenic
1123870787 15:24570284-24570306 CTGTAATCCCAGACTAGCCTGGG - Intergenic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124529667 15:30494205-30494227 CTGTAACAGCAGCTGAGTCTTGG - Intergenic
1124768992 15:32513482-32513504 CTGTAACAGCAGCTGAGTCTTGG + Intergenic
1125627781 15:41122866-41122888 CTGTAATCCCAGCAGCTACTTGG - Intergenic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127485126 15:59411788-59411810 CTGTAGTCCCAGCTGAGTCTGGG + Intronic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1128044216 15:64603392-64603414 CTGTAATCCCAGCTACTTCTGGG - Intronic
1128373352 15:67057443-67057465 CTGTAATCCCAGCTACTACTCGG - Intergenic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128674402 15:69598010-69598032 CTGAAATCTGAGCTGAGGATAGG + Intergenic
1128862298 15:71084038-71084060 TTGTCAACCCAGCTCAGGCTGGG - Intergenic
1129647749 15:77453103-77453125 CTGTAATCCCAGCTACTACTTGG + Intronic
1130563276 15:84975101-84975123 CAGTAATCCCAGGTGAGGCCTGG + Intergenic
1130601175 15:85274734-85274756 CTGGAATCCGATTTGAGGCTGGG - Intergenic
1130803613 15:87293650-87293672 CTGTAACCATAGCTGAGTCTTGG - Intergenic
1131235444 15:90692876-90692898 CTGTAATCCCAGCGGGGCCGAGG - Intergenic
1131354140 15:91729708-91729730 CTGAAATCCAAGCCCAGGCTTGG - Intergenic
1131387021 15:92016408-92016430 CTATAATCCCAGCTGAGTTGGGG - Intronic
1131824889 15:96312313-96312335 CTGGAATTCCAGCTGTGGATGGG + Intergenic
1132494709 16:256694-256716 CTGTAATCCCAGCTACTACTTGG - Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1134895738 16:17885285-17885307 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1135058099 16:19247487-19247509 CTGTAATCCCAGCAGCACCTTGG - Intronic
1135218060 16:20589909-20589931 CTGTAATCCCAGCTACTGGTGGG + Intergenic
1135336200 16:21603259-21603281 CTGTAATCCCAGCTATGGAGAGG - Intronic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1137340321 16:47596013-47596035 CTGTAATTCAAGCTGAGCTTTGG - Intronic
1137665670 16:50247485-50247507 CTGTAATCCCAGCTGCTACTCGG - Intronic
1137690936 16:50427061-50427083 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1137993187 16:53180796-53180818 CTGTAGTCCCAGCTAATACTGGG - Intronic
1138128615 16:54459101-54459123 TTGTCATCCCAGCCAAGGCTGGG - Intergenic
1138590218 16:57995636-57995658 TTGTCAGCCCACCTGAGGCTGGG - Exonic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1139607327 16:68028842-68028864 CTTGAATCCCAGCTGTGCCTCGG - Intronic
1139953003 16:70680958-70680980 CTGCATTCCCAGCTGAGGTGAGG - Exonic
1140109605 16:71992120-71992142 CTGTAATCCTAGGTGTGGCTTGG - Intronic
1140906047 16:79410055-79410077 CTGTAACCACAGCAGAGTCTTGG + Intergenic
1141417968 16:83891463-83891485 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1141683870 16:85559115-85559137 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1141727894 16:85801681-85801703 ATGAAAACCCAGCTCAGGCTAGG - Intronic
1141982107 16:87557044-87557066 GAGTGATCCCAGCTGTGGCTGGG - Intergenic
1142581156 17:943697-943719 CTGTAATCCCAGCTACGACTCGG + Intronic
1143086770 17:4421885-4421907 CTGTAATCCCAGCTACTTCTGGG + Intergenic
1143474464 17:7194770-7194792 CTGGAATCCCAGCTGACTTTGGG + Intronic
1143493765 17:7298896-7298918 CTGTAGTCCCAGCTCAGGAGTGG - Intergenic
1143531671 17:7508685-7508707 CTGTAATCCCAGCTGCTAGTTGG + Intronic
1144090329 17:11850523-11850545 CTGTAATCCCAGCTGTAATTTGG + Intronic
1144381625 17:14704146-14704168 CTGTAACAACAGCTGAGTCTTGG - Intergenic
1144657571 17:17047053-17047075 CTGTAATCCCAGCTACTCCTTGG + Intronic
1145031157 17:19506364-19506386 CTGTAATCCCAGCTAAGTGGGGG + Intronic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1146034959 17:29398326-29398348 CTGTAATCCCAGCTGTTGGGAGG - Intronic
1146070117 17:29672827-29672849 CTGTAATCCCAGCTACTACTCGG - Intronic
1146218217 17:30995877-30995899 CTGTAATCCCAGCTACTACTAGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147028182 17:37607832-37607854 CTGTAATCCCAGCTGCTCCGAGG + Intronic
1147060088 17:37869065-37869087 CTGTAATCCTAGCATAGGCGTGG + Intergenic
1147504519 17:41002315-41002337 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1147572782 17:41581664-41581686 CAGAAATGGCAGCTGAGGCTGGG + Intergenic
1147691914 17:42321073-42321095 CTGTAATCTCAGCTGGGCATGGG - Intronic
1147889843 17:43709636-43709658 CTGTAATCCCAGCTACTACTCGG - Intergenic
1148409356 17:47451521-47451543 CTGTAATCCTAGCATAGGCATGG + Intergenic
1148409361 17:47451554-47451576 CTGTAATCCTAGCATAGGCATGG + Intergenic
1150236162 17:63594518-63594540 CTGTGATCCCAGCTGAGGCATGG + Intergenic
1150696231 17:67408075-67408097 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1150889915 17:69135810-69135832 CTGGAATCTCACCTGAGGCTGGG + Intronic
1151440481 17:74125698-74125720 CTGTAGTCCCAGCTGTGCTTGGG - Intergenic
1151646288 17:75434370-75434392 TTGTAATACCAGCTGAACCTAGG - Intergenic
1151848025 17:76671658-76671680 CTGTAATCCCAGGCCGGGCTGGG + Intergenic
1151871921 17:76842205-76842227 CTCTAATTATAGCTGAGGCTTGG + Intergenic
1152592401 17:81220146-81220168 CAGTGGACCCAGCTGAGGCTGGG - Intronic
1152699943 17:81813756-81813778 CTGGACGCCCAGCTGAGGCTGGG + Exonic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1153840882 18:9006692-9006714 CTGTAATCCCAGCTGCTACTGGG - Intergenic
1153867672 18:9287849-9287871 ATGAAATTCCAGCTGTGGCTGGG - Intergenic
1153896573 18:9567473-9567495 CTGTAATCCCAACTGAGGACAGG - Intronic
1153920466 18:9784673-9784695 CTGTAATCCCAGCTACGTCGGGG - Intronic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1154365788 18:13707743-13707765 CTGTAACAACAGCTGAGTCTTGG + Intronic
1155338061 18:24785266-24785288 CTGTCATCCCAGCCCTGGCTCGG + Intergenic
1155750460 18:29416874-29416896 CTATCCTCCCAGCTCAGGCTTGG + Intergenic
1156552431 18:38031702-38031724 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1158128073 18:54123638-54123660 TTCTCATCCCAGCTGAGGGTGGG + Intergenic
1158612986 18:58960164-58960186 CTGTAATCCCACTTGAGGTCAGG - Intronic
1159050775 18:63419289-63419311 CTGTAATCCCAGCTGCTACATGG + Intronic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1160202072 18:76804290-76804312 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1161050772 19:2163194-2163216 CTGTAATCCCAGCTACTGCGGGG - Intronic
1161903816 19:7139948-7139970 CTATAATCCCAGCTGCTCCTCGG - Intronic
1162338896 19:10079533-10079555 CTGTAATCCCAGCTACTACTTGG + Intergenic
1162505714 19:11083475-11083497 CTGTAGTCCCAGCTGCGGAGAGG - Intergenic
1162738398 19:12759459-12759481 CTGTAATCCCAGCTGGGAGGTGG + Intergenic
1163261820 19:16195524-16195546 CTGTAGTCCCAGCTGAGCCAAGG + Intergenic
1163384944 19:16993878-16993900 CTATAATCCCATGTGAGGCCAGG + Intronic
1163448771 19:17363287-17363309 CTGTTATCCCAGCTGCTTCTTGG - Intronic
1163531748 19:17854052-17854074 CCGTGATCCAAGCTGTGGCTTGG + Intergenic
1163957769 19:20660135-20660157 CTGTAATCCCAGCTACTGGTGGG + Intronic
1164158502 19:22611063-22611085 CTGTGATCCCAGGTGAAGTTGGG + Intergenic
1164550685 19:29209713-29209735 CTGTAATCCCAGGTAGTGCTAGG - Intronic
1164666735 19:30044120-30044142 CTGTAATCCCAGCTACTACTCGG - Intergenic
1164976109 19:32573959-32573981 CTGTAATCCCAGCAGGGATTTGG + Intergenic
1165019505 19:32912078-32912100 CTGTAATCCCAGCTATGAGTGGG + Intronic
1165082533 19:33317277-33317299 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1165616081 19:37202135-37202157 CTGTAATCCCAGCTACTGGTAGG - Intronic
1165747755 19:38240429-38240451 CTGTAATCCCAGCTACTACTTGG + Intergenic
1165932020 19:39365429-39365451 CTGTAATCCCAGCTACTGGTGGG + Intronic
1166099598 19:40563779-40563801 CTGTAATCTCGGCTGAGATTGGG + Intronic
1166278085 19:41769066-41769088 CTGTAATCCCAGCTGTGCAGGGG - Intronic
1166740509 19:45112092-45112114 CTGTAATCCCAGCTGGGATTTGG - Intronic
1167115150 19:47484824-47484846 CTGTAATCCCAGCTGCTGGGAGG - Intergenic
1167143278 19:47666831-47666853 CTGTAATCCCAGCCAAGGCAGGG - Intronic
1167199897 19:48057610-48057632 CTGTAATCCCAGCTGCTAGTGGG - Intronic
1167207292 19:48111233-48111255 CTGTAATCCCAGCTACTACTCGG + Intergenic
1167519882 19:49948120-49948142 CTGAAGTCTCAGCTGACGCTGGG - Intronic
1168496550 19:56856285-56856307 CTGTAATCCCAGCTACTACTCGG + Intergenic
1168541590 19:57216227-57216249 CTGTAATCCCAGCTGCTGGGGGG + Exonic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
926353485 2:12018838-12018860 CTGTAACAACAGCTGAGTCTTGG + Intergenic
926409381 2:12586978-12587000 CTGTGAACTCATCTGAGGCTTGG + Intergenic
926438861 2:12865971-12865993 CTGTCATCCCAGCTAAGGAAGGG - Intergenic
926747185 2:16168501-16168523 TTCAAATCCCAGCTCAGGCTTGG - Intergenic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
926886638 2:17604421-17604443 CTGTACTGCCAGCTCTGGCTGGG - Intronic
927150688 2:20194004-20194026 CTGTAATCCCAGCTACTACTCGG + Intergenic
927704785 2:25290442-25290464 CTGTAATCCCAGCTACTGGTTGG - Intronic
927902218 2:26828730-26828752 CTGTAATCCCAGCTAGTACTCGG + Intergenic
928302569 2:30139212-30139234 CTGTAACAACAGCTGAGTCTTGG + Intergenic
928311294 2:30212258-30212280 CTGTAAAACCATCTGAGCCTAGG + Intergenic
928387612 2:30883603-30883625 CTGTTATGCCACCTGTGGCTTGG - Intergenic
928491697 2:31791002-31791024 CTGTAATCCCAGACAAGACTGGG + Intergenic
928498383 2:31859825-31859847 CTGTAATCCCAGCTTAAGGGAGG + Intergenic
928555732 2:32423060-32423082 CTGTAATCCCAGCTAACCTTGGG - Intronic
928640780 2:33296619-33296641 TTGCCATCCCAGCTGAGCCTGGG + Intronic
928930755 2:36621194-36621216 CTGGAATCCCAGCTCAGGCTTGG + Intronic
929204455 2:39275227-39275249 CTGTAATCCCAGCACTGGGTGGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930951694 2:57150413-57150435 CTGTAAACCCAACTGGGACTGGG - Intergenic
931315832 2:61130232-61130254 CTGTAATCCCAGTTGTTGCCTGG - Intronic
931855899 2:66301622-66301644 CGGAAATGCAAGCTGAGGCTGGG + Intergenic
931986861 2:67750635-67750657 CTGTACTCCCAGCTGAGGCAGGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
933737188 2:85504601-85504623 CTGTAATCCCAGCTTTTGGTAGG - Intergenic
934475427 2:94590303-94590325 CTGTAATCCCAGCTGGGGTGGGG - Intronic
935115573 2:100133048-100133070 CTGTAATCCCAGCTGTTGGGAGG - Intronic
935402221 2:102671981-102672003 CTGTAATCCCAGCTGCTACTTGG + Intronic
935837907 2:107075556-107075578 CTGTTCTCCCAGCCCAGGCTGGG + Intergenic
938112855 2:128580824-128580846 TTGTAATCCCTGCTGAGGCAGGG - Intergenic
938377816 2:130820075-130820097 CTGCTATCCCAGCTGGGCCTGGG - Intergenic
938679782 2:133677936-133677958 CCATAATCCCAGCTGAGGCAGGG - Intergenic
939122696 2:138137232-138137254 CTGCAATCTCAAGTGAGGCTTGG + Intergenic
939661290 2:144893689-144893711 CTGTAATACCAGATGTGGATAGG - Intergenic
939872526 2:147541180-147541202 CTGTGATCTCATCTGAGGCTTGG - Intergenic
940133100 2:150406466-150406488 CTGTAATCCAATCTGAGACATGG - Intergenic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
941262348 2:163313693-163313715 ATGTACTACCAGCTGTGGCTTGG - Intergenic
941901907 2:170687084-170687106 CTGTAATCCCAGCTGAGTGAGGG + Intergenic
943332123 2:186572286-186572308 CTGTAGTCCCAGCTGCTACTTGG + Intergenic
943367975 2:186983270-186983292 ATGTTATGCCAGCTGAGGCCAGG - Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
943969679 2:194387036-194387058 CTGTAACAACAGCTGAGTCTTGG - Intergenic
945042406 2:205753157-205753179 CTGTAATCACAAGAGAGGCTGGG - Intronic
945254168 2:207790216-207790238 CTGTAATCCCAGCTGTTGGGAGG - Intergenic
946137795 2:217662378-217662400 CTGTAATCCCAGCTACTACTTGG + Intronic
946284351 2:218691816-218691838 CTGTAATCCCAACAGGGGATTGG - Intronic
946387061 2:219389705-219389727 CTGTAATCCCAGCAGCTACTTGG + Intronic
947414267 2:229877405-229877427 CTGTAATCCCAGCTACTACTTGG + Intronic
947514464 2:230789975-230789997 CTGTAATCCCAGCACAAGTTGGG + Intronic
947662544 2:231880505-231880527 CTGTAATCCCAGCACAGTTTGGG - Intergenic
948930241 2:241127241-241127263 CTCCAGTCCCAGCTGAGGATGGG - Exonic
1169365167 20:4986208-4986230 CTATAATCCCAGCAGAGGCGGGG + Intronic
1169650505 20:7861434-7861456 TTGTAGTCCCAGCTGCTGCTTGG + Intergenic
1170646378 20:18199533-18199555 CTGTAATCCCAGCTCCTCCTTGG + Intergenic
1172255422 20:33513482-33513504 CTGTAATCCCAGCTGTAATTGGG - Intronic
1172564258 20:35916587-35916609 CTGTAATCCCAGCTATGGGGAGG - Intronic
1172576327 20:36011560-36011582 CTGTAATCCCAGCTGAATCCAGG + Intronic
1174162470 20:48561413-48561435 CTGTAATCCCAGCTGCCGGGAGG + Intergenic
1174202496 20:48816780-48816802 CTGTGATCTCATCTGATGCTTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174915010 20:54644755-54644777 CTGTAATCCCAGCTGAGTCAGGG + Intronic
1175011865 20:55745610-55745632 CTGCACGCCCATCTGAGGCTTGG - Intergenic
1175019184 20:55826292-55826314 CTGTGGTCCCATCTAAGGCTGGG + Intergenic
1175103510 20:56596981-56597003 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1175326282 20:58130652-58130674 CTGTAATCCCAGCTAAGAAGTGG + Intergenic
1175413360 20:58785815-58785837 CTGTATGCCCAGCTCATGCTAGG + Intergenic
1175583071 20:60115678-60115700 CTGTCATCCCAGCAGCGGCATGG - Intergenic
1175622146 20:60457092-60457114 CTGTAATCCCAGCTGTAATTGGG - Intergenic
1176051046 20:63119954-63119976 CTGTCATCCCAGCTGACCCCTGG + Intergenic
1177041140 21:16113047-16113069 CTGTAATGTCAGCTGTGGGTTGG - Intergenic
1177474585 21:21603092-21603114 CTGTAATCCCAGCTACTACTCGG + Intergenic
1179240917 21:39591321-39591343 CTGTAGTCCCAGCTGAGCCTGGG + Intronic
1179321302 21:40293697-40293719 CTGTAATCCCAGCTACTACTTGG + Intronic
1181014860 22:20062994-20063016 CTGTAATCCCAGCTGACGGCTGG + Intronic
1181481361 22:23201263-23201285 CTGCATTCCCTGCTGGGGCTTGG + Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182032445 22:27170106-27170128 ATGTAATCTCAGCTCAGGGTTGG - Intergenic
1182498154 22:30725383-30725405 CTGTAATCCCAGCTACTACTCGG + Intronic
1183494744 22:38136464-38136486 CTGTAATCCCAGCTACTACTCGG + Intronic
1184002304 22:41684024-41684046 CTGTAATCCCAGCTACTGGTGGG - Intronic
1184210831 22:43034751-43034773 CTGTAATCCCAGCTACTTCTTGG + Intergenic
1184521386 22:44996215-44996237 CTGCCATCCCTGCCGAGGCTGGG + Intronic
1184934924 22:47714188-47714210 CTATCATCTCAGCAGAGGCTGGG - Intergenic
1185249245 22:49791130-49791152 CTGGAATCCCAGCTGTGGCGTGG + Intronic
1185253796 22:49820476-49820498 CTGTATTCCCAGCTGAGGCTGGG + Intronic
949525705 3:4901268-4901290 CTGTAGTCCCAGCTGAGAGGTGG - Intergenic
949556337 3:5156709-5156731 CTGAAATCCCATTTGAGGCCGGG - Intronic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
951981564 3:28572821-28572843 CTGTAATCCCAGCTGCTTCGGGG - Intergenic
952005377 3:28836956-28836978 CTGGAAAACCAGCTGAGACTGGG + Intergenic
953759056 3:45672655-45672677 CTATAATCCCCACTGAGTCTTGG + Intronic
953879131 3:46682573-46682595 CTGTTTTCCCAGCTGTGGCATGG + Intronic
954670010 3:52285708-52285730 CTGTAATCCCAGCTACTGGTGGG - Intronic
955011882 3:55025507-55025529 CTGTGATCCCAGCTGCTACTCGG + Intronic
955278155 3:57567837-57567859 CTGTAATCCCACCTGAGGTCAGG + Intergenic
955341157 3:58126252-58126274 CTGTAATCCCAGCTACTACTTGG + Intronic
955760476 3:62275552-62275574 CTGTAATCCCAGAGCAGCCTGGG + Intronic
955790432 3:62583582-62583604 CCATAATCCCAGCTCAGGCTTGG + Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956156485 3:66303819-66303841 CTGTGATCTCATCTGAGGCTAGG + Intronic
956627580 3:71281803-71281825 CTCAAATCTAAGCTGAGGCTGGG + Intronic
959699536 3:109285740-109285762 CTGTAGTCCCAGCTGCTCCTAGG - Intergenic
959701620 3:109304145-109304167 CTGTAATCCCAGCTGAGACTCGG + Intronic
960144486 3:114186248-114186270 CTGTAATCCCAGCTGAGATTGGG - Intronic
960608458 3:119532204-119532226 TTGAAATGCCATCTGAGGCTGGG + Intronic
960919432 3:122731621-122731643 CTATAATCCCAGCTAAGCCAGGG - Intergenic
961472305 3:127123508-127123530 CCGTAATCTCAGCTGATTCTGGG - Intergenic
961534134 3:127559123-127559145 CTGTAATCCCAGCTACTACTTGG + Intergenic
962561293 3:136609216-136609238 CTGTAATGCCAGCAGAGGTCAGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963935454 3:151047518-151047540 CTGTAATCCCCGCTGCTACTCGG + Intergenic
965409359 3:168310558-168310580 CTATAACCCCAGCAAAGGCTGGG - Intergenic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
965896167 3:173579221-173579243 CTGTAATCCCAGCACAGCCAAGG + Intronic
966187813 3:177244025-177244047 CTGTAATCCCAGCTCTGTCTAGG + Intergenic
966358402 3:179107149-179107171 CTGTAATCCCAGCTACTGCGTGG + Intergenic
966536108 3:181036014-181036036 CTGTAATAACAGCTAAGTCTTGG - Intergenic
967061009 3:185872691-185872713 CTGTAATCCCAGCTACTCCTCGG - Intergenic
967796061 3:193600016-193600038 CTGTAATAACAGCTGAGTGTTGG - Intronic
967821846 3:193845978-193846000 GTGGGAGCCCAGCTGAGGCTGGG - Intergenic
967919085 3:194601258-194601280 CTGTAATCCCAGCTACTACTGGG - Intronic
968033476 3:195524397-195524419 CTGTAATCCCAGCTACTACTGGG + Intronic
968190973 3:196666871-196666893 CTGTAATCCCAGCTACTGCGGGG + Intronic
968481065 4:833304-833326 CTGTGATGGCAGCTCAGGCTGGG + Intergenic
968543624 4:1183011-1183033 CTGTAATCCCAGCTGAGGTCAGG + Intronic
968875806 4:3267382-3267404 CTGTAATCCCAGCTACTCCTCGG + Intronic
969375109 4:6758082-6758104 CTGTAATCCCAGCACAAGGTGGG + Intergenic
970483201 4:16498558-16498580 CTGTAAGGTAAGCTGAGGCTGGG + Intergenic
970493325 4:16598791-16598813 CTTTATTCCCAGCTGAGACTAGG - Intronic
970768929 4:19586246-19586268 CTGTAATCCCAGCTACTCCTGGG - Intergenic
971192129 4:24437760-24437782 CTGTAATCCCACTTGAACCTGGG - Intergenic
971221845 4:24716106-24716128 CTGTAATCCCAGCTGATTCCAGG - Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
972537705 4:40013101-40013123 CTGTAATCCCAGCTATGGAGAGG - Intergenic
974759881 4:66261300-66261322 CTGTAATCCCAGCTACTCCTGGG - Intergenic
975344452 4:73277900-73277922 CTGTAATCCCAGCTACTACTCGG - Intergenic
975724083 4:77275368-77275390 CTGTCAACTCAGCTGAGGGTTGG + Intronic
975978003 4:80121148-80121170 CTGTAGTCCCAGCTGCTACTCGG + Intronic
977351259 4:95890739-95890761 CTATAATCCCAGTGGAGGCCAGG - Intergenic
978337687 4:107687525-107687547 CTTTCATGCCAGCTCAGGCTGGG - Intronic
978885567 4:113762354-113762376 CAGTGAACCCTGCTGAGGCTGGG - Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
980092625 4:128458232-128458254 CTGTAATCCCAGCCAGGGCAGGG + Intergenic
980266281 4:130521315-130521337 CTGTAATTCCAGCTATGACTCGG - Intergenic
980613228 4:135184914-135184936 CTCTCCTTCCAGCTGAGGCTGGG - Intergenic
981080956 4:140638566-140638588 CTGTAATCCCAGCTGTACCTGGG + Intronic
981103749 4:140857679-140857701 CTGTAATCCCAGCTCCTCCTCGG + Intergenic
981147517 4:141342825-141342847 CTGTAATCCCACTTGAGGCCAGG + Intergenic
981233387 4:142386526-142386548 CTGTAACAACAGCTGAGTCTTGG + Intronic
981312760 4:143313036-143313058 CTGTAATCCCAGCTAATAGTGGG - Intergenic
982019871 4:151192064-151192086 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
982174656 4:152694353-152694375 CTGTAATCCCAGCTACTACTTGG + Intronic
982303040 4:153899551-153899573 CTGTAATCCCAACAGTAGCTGGG + Intergenic
984047865 4:174824086-174824108 CTGAATTCCTAGCTGAGGCCAGG + Intronic
984083929 4:175284871-175284893 CTGTAATCCCAGCTACCACTTGG - Intergenic
984870582 4:184321538-184321560 CTGTAATCCCAGCTGACTATGGG - Intergenic
986169219 5:5302150-5302172 GTGCAAAACCAGCTGAGGCTTGG + Intronic
986210045 5:5663484-5663506 ATGTAATCCCAGCTACTGCTTGG - Intergenic
986601128 5:9474250-9474272 CCGTACACCCAGCTGAGGCCAGG + Intronic
986664475 5:10088585-10088607 CTGTGATCCCATCTGACACTTGG + Intergenic
987456651 5:18155442-18155464 CTGTGATCTCATCTGAAGCTCGG - Intergenic
988649221 5:33130062-33130084 CTGTAATCCCAGCTAAGATTCGG - Intergenic
988799673 5:34684513-34684535 CTGTCACTCCCGCTGAGGCTGGG + Intronic
989243431 5:39226114-39226136 CTGAAATGCGAGCTGAGGATTGG + Intronic
990082104 5:51929631-51929653 CTGTAACAACAGCTGAGTCTTGG + Intergenic
990099451 5:52163289-52163311 CTGTAATCCCAGCTACTGGTGGG + Intergenic
991058519 5:62345422-62345444 CTGTAATCCCAGCTGCTACTTGG + Intronic
992326051 5:75661272-75661294 CTGTAATCCCAGCTACAGCGGGG + Intronic
992437247 5:76766505-76766527 CTGTAATCCCAGCTACTACTCGG + Intergenic
992782131 5:80137514-80137536 CTGTAGTCCCAGCTGCTACTCGG + Intronic
995051192 5:107705789-107705811 GACTAAACCCAGCTGAGGCTGGG + Intergenic
996032498 5:118721569-118721591 CTGTAATCCCAGCTACTCCTTGG + Intergenic
996474855 5:123905292-123905314 CTGTAACAACAGCTGAGTCTTGG + Intergenic
997659152 5:135576759-135576781 CAGAAATCTCTGCTGAGGCTGGG - Intronic
998360807 5:141585077-141585099 CTGTAATCCCAGCTACTGCCAGG - Intronic
999177965 5:149645284-149645306 CTGTAATCCCAGCGGAGGCGAGG - Intergenic
1001408260 5:171492158-171492180 CTGTAATCCCAGCTACTACTAGG - Intergenic
1001550870 5:172601578-172601600 CTATAATCCCAGCTGAGGCAGGG - Intergenic
1001919895 5:175591465-175591487 CTGTAATCCCAGCCGCTCCTGGG + Intergenic
1001955010 5:175843021-175843043 CTGTAATCCTAGCTCAGCCTGGG - Intronic
1002034505 5:176456622-176456644 CAGAAATTCCAGTTGAGGCTGGG - Intronic
1002060908 5:176625555-176625577 ATTCAAACCCAGCTGAGGCTGGG + Intronic
1002327552 5:178419773-178419795 CTGTAACAACAGCTGAGTCTTGG + Intronic
1002705522 5:181158979-181159001 CTATAATCCCAGCTGATAATGGG + Intergenic
1004212687 6:13666927-13666949 TTGTAATACCAGTTGTGGCTGGG + Intronic
1004451034 6:15746732-15746754 CTGTAATCCCAGCTACTACTTGG + Intergenic
1004871253 6:19906823-19906845 CTGGAAGCCCAGCAGAGCCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006582463 6:35084785-35084807 CTCAAATTCCTGCTGAGGCTCGG + Intronic
1006762476 6:36475321-36475343 CTATAATCCCAGCTGCTACTTGG + Intronic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006966266 6:37989027-37989049 CTGTAATCCCAGCTACTACTGGG - Intronic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007533825 6:42566508-42566530 CTGTAATCCCAGCTGTAATTCGG - Intronic
1008112456 6:47507566-47507588 CTGTAATCCAAGGGGAGGCAAGG - Intronic
1008276269 6:49548128-49548150 CTGTAATCCCAGCTTACTCAGGG + Intergenic
1008680644 6:53868345-53868367 CTGTAATCCCAGCTACTTCTCGG - Intronic
1011313989 6:86011043-86011065 CTGTAATCCCAGCTATAGCGGGG + Intergenic
1011473575 6:87731451-87731473 CTGTAATCCCAGCAGTAGTTTGG - Intergenic
1011618965 6:89224212-89224234 CTGTAATCCCAGCTACTACTTGG - Intronic
1011648003 6:89478609-89478631 CTGTAATCCCAGCCGGGGTGAGG + Intronic
1012109825 6:95215290-95215312 CTACAATCTCATCTGAGGCTAGG - Intergenic
1012163415 6:95917218-95917240 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1012597624 6:101058392-101058414 CTATAATCTCATCTGAGCCTTGG + Intergenic
1013057439 6:106597464-106597486 CTGTAATCCCAGCTATGGAGAGG - Intronic
1013568220 6:111391669-111391691 ATGTGATCCCAGCTTCGGCTTGG + Intronic
1014700825 6:124685982-124686004 CTGTGTTCTCAGCTGAGGCTTGG + Intronic
1014726879 6:124981903-124981925 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1014932035 6:127346338-127346360 CTGTAGTCCCAGCTAAACCTGGG + Intergenic
1014934039 6:127365553-127365575 CTGTGATCCCAGCTTGGTCTGGG - Intergenic
1015208859 6:130672595-130672617 CCGTGTTCTCAGCTGAGGCTCGG - Intergenic
1015362493 6:132355501-132355523 CTGTAAGGCCACTTGAGGCTTGG - Intronic
1015495900 6:133883036-133883058 CTGCCATCCCAGCTGAGGCCTGG + Intergenic
1015496336 6:133887872-133887894 GTGAATTCCCAGCTGAGCCTAGG + Intergenic
1015607184 6:134970253-134970275 CTGTAATCCCAGCTGCTGTAAGG - Intronic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1017705592 6:157119738-157119760 CTGTAATCCCAGCTGTTAATGGG - Intronic
1017976776 6:159365207-159365229 CTGTCATCCCAGCTGCATCTGGG - Intergenic
1018104213 6:160467630-160467652 CAGTACTCCCACCTGACGCTGGG + Intergenic
1018112458 6:160548570-160548592 CAGTACTCCCACCTGATGCTGGG + Exonic
1018130817 6:160731118-160731140 CAGTACTCCCACCTGACGCTGGG - Exonic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1019040741 6:169102273-169102295 CAGAAATACCAGCTGTGGCTGGG + Intergenic
1019688732 7:2397693-2397715 CTGTAATCCCAGCTATGGGGAGG - Intergenic
1019703373 7:2485733-2485755 CTGTAATCCCAGCTACGGGGAGG - Intergenic
1019758070 7:2788030-2788052 CTGTAATCCCAGCTGCTCGTGGG + Intronic
1019900004 7:4012832-4012854 CTGTAATCCCAGCTGAGGATTGG - Intronic
1020197536 7:6053485-6053507 CTGTAATCCCAGCTGTAATTTGG - Intronic
1020836801 7:13163770-13163792 CTGTAATAATAGCTGAGTCTTGG + Intergenic
1020937678 7:14487723-14487745 CTGTAATCCCAGCTTACTCGAGG - Intronic
1022727426 7:32993700-32993722 CTGTAATCTCAGCTGAGGCAGGG + Intronic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023427165 7:40050099-40050121 CTGTAATCCCAGCTATCGGTAGG - Intronic
1023839652 7:44089234-44089256 CTGTAATCCCAGCTACTGGTTGG - Intergenic
1024639671 7:51318232-51318254 CTGTAATCCCAGCTACGGGGCGG + Intergenic
1024774960 7:52773493-52773515 CTGCAATCTCATCTAAGGCTCGG + Intergenic
1024968115 7:55043482-55043504 CTGTAATCCCAGCTACTACTTGG - Intronic
1025046157 7:55693949-55693971 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1025262679 7:57430327-57430349 CTGTAATCCCAGCTACTGCGGGG - Intergenic
1025932777 7:66009956-66009978 CTATAATCCCAGGGGAGGCCTGG - Intergenic
1026174355 7:67982914-67982936 CTGTAATCCCAGCTAACTCAGGG - Intergenic
1026218981 7:68375083-68375105 CTGTAATCCCAGCTACTCCTAGG + Intergenic
1026317494 7:69239836-69239858 CTGTAATCCCAGCAGGCGTTTGG - Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1026902766 7:74046206-74046228 CTGGAATCCCAGGTGAGGCAAGG + Exonic
1026984966 7:74549027-74549049 CTGTAATCCCAGCTGGCATTTGG + Intronic
1027845001 7:83361445-83361467 ATGTAAAGCCAGCTAAGGCTAGG - Intergenic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1028125913 7:87113364-87113386 CTGCAATCTCATCTGAGGTTTGG - Intergenic
1028465613 7:91148260-91148282 CTGTGGTCCCAGCTGAGGTGGGG + Intronic
1029053772 7:97718115-97718137 CTGTAATCCCAGCTAAAGGGAGG + Intergenic
1029127500 7:98304774-98304796 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1029129793 7:98321429-98321451 GTGTATTCCCAGCAGAGGCAGGG - Intronic
1029369871 7:100142456-100142478 CTGTAATCCCAGCAGGTGGTAGG + Intergenic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1030564798 7:111140181-111140203 CTGAAATCCCCCCTGAGTCTTGG - Intronic
1030575141 7:111276556-111276578 CTGTGATCCCATCTGATCCTGGG + Intronic
1030876592 7:114820564-114820586 CTGTAATCCCAGCTACTGCGGGG + Intergenic
1031049254 7:116928512-116928534 CTGCAATCTCATCTGAGGCTTGG + Intergenic
1031916352 7:127566413-127566435 CTGTAATTCCAGTTGGGGTTTGG - Intergenic
1032963786 7:137071855-137071877 CTGTAATCCCAGCTATGGGGAGG + Intergenic
1033286321 7:140043651-140043673 CTGTAATCCCAGCTACTCCTCGG - Intronic
1033340259 7:140486436-140486458 CTGTAATCCCAGCTGCTCCCAGG - Intergenic
1033371979 7:140717391-140717413 CTGTGATCCCAGCTGAGGTCGGG - Intronic
1035213976 7:157350813-157350835 CTGTAACGCCAGCTAAGACTCGG - Intronic
1035713157 8:1733873-1733895 CTGTAATCCCAGCACAAGGTGGG + Intergenic
1035925793 8:3726227-3726249 CTGTAAACCCATGAGAGGCTGGG + Intronic
1036943567 8:13073418-13073440 CTGTAATCCCAGGTGACACTCGG + Intergenic
1037314438 8:17587751-17587773 CTGTAATCCCAGCTACCACTCGG - Intronic
1037568783 8:20141144-20141166 CTGTAATCCCAGCTACCCCTTGG + Intergenic
1037868838 8:22472002-22472024 CTGTAGTCCCAGCTGAGGACTGG + Intronic
1038257987 8:25968682-25968704 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1038477373 8:27877700-27877722 CTGTTCTCCCACCTAAGGCTTGG - Intronic
1039502341 8:38027994-38028016 TTGTAATCCCAGCTAGGGCTGGG + Intergenic
1039517790 8:38147830-38147852 CTGTCAGCCCACCTGTGGCTGGG - Intronic
1040350428 8:46561340-46561362 CTGTCATCCCAGATGAGTGTTGG + Intergenic
1041589534 8:59560887-59560909 CTGTAATGCCAGCTGAGGTCAGG + Intergenic
1041909419 8:63072488-63072510 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1042034262 8:64514017-64514039 CTGTAACAACAGCTGAGTCTTGG + Intergenic
1042529765 8:69803069-69803091 CTGTAATCCCAGATCAGCCTGGG + Intronic
1042561805 8:70077541-70077563 CTGTAGTCCCAGCTCAGTCCTGG - Intergenic
1042603963 8:70527806-70527828 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1042928299 8:73989171-73989193 CTGTGGTCCCAGCTGAGCCCAGG + Intergenic
1043458624 8:80437334-80437356 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1044497068 8:92899240-92899262 CTGTAATCCCAGGTGTGATTTGG - Intronic
1045471212 8:102513984-102514006 CTGGAATCCTAGCTAAGCCTGGG - Intergenic
1046898780 8:119501408-119501430 CTGTAACAACAGCTGAGTCTCGG - Intergenic
1046925505 8:119782883-119782905 CTGTAATCCCAGCTGTGTTGGGG + Intronic
1048741650 8:137567310-137567332 CTGTAGTCCCAGTTAAGGATAGG - Intergenic
1048838818 8:138546846-138546868 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1049086352 8:140481334-140481356 CTGTAATCCCAGCACGGCCTTGG + Intergenic
1049638586 8:143703523-143703545 CTGTAATCCCAGCTGTAATTGGG - Intronic
1051009731 9:12396765-12396787 CTTTAAGCACAGCTGAGTCTAGG + Intergenic
1051904390 9:22078808-22078830 CTATAATCTTAGCTGAGGTTTGG + Intergenic
1052294672 9:26883224-26883246 CTGTAATTCCAGATGAGATTTGG - Intronic
1052342235 9:27375124-27375146 TTGTAAGGCCAGGTGAGGCTTGG + Intronic
1052756492 9:32547955-32547977 CTGTAATCCCAGCTACTACTGGG - Intronic
1052763794 9:32619654-32619676 TTGTAATCCCAGCACAGCCTGGG + Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053218911 9:36295099-36295121 CTGTAATCCCAGCTAAACTTGGG + Intronic
1053435392 9:38070223-38070245 CTGTAATCCCAGCAGCTACTCGG + Intergenic
1053682639 9:40495759-40495781 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1053932622 9:43124100-43124122 CTGTAATACCAGCTGGGGTGGGG + Intergenic
1054281075 9:63129170-63129192 CTGTAATCCCAGCTGGGGTGGGG - Intergenic
1054295738 9:63331273-63331295 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054393757 9:64635768-64635790 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054428405 9:65140981-65141003 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054501974 9:65880564-65880586 CTGTAATCCCAGCTGGGGTGGGG - Intronic
1054729494 9:68686371-68686393 CTGTAATCCCAGCTACTACTTGG + Intergenic
1054810873 9:69432930-69432952 TTCTCATCCCAGCTGGGGCTGGG + Intronic
1054999346 9:71430687-71430709 CTGTAATCCCAGCTGCTGGGAGG + Intronic
1055700462 9:78939365-78939387 TTACAATCCCAGCTGATGCTAGG - Intergenic
1055703796 9:78975540-78975562 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1057231052 9:93321488-93321510 CCCTGCTCCCAGCTGAGGCTTGG - Intronic
1057238418 9:93386334-93386356 CTGTAATCCCAGCTACTACTCGG + Intergenic
1058315590 9:103561386-103561408 CTGTAGTCCCAGCTGCTCCTCGG - Intergenic
1058326795 9:103708487-103708509 CTTTGATCCCATCTGAGGGTTGG + Intergenic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1058677309 9:107411335-107411357 CTGTAATCCCAGCTACTACTCGG - Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060582279 9:124760187-124760209 CTGTAATCCCAGCTGCTCCAGGG + Intronic
1060642308 9:125249321-125249343 CTGTAATCCCAGCTACAGGTTGG - Intergenic
1060902856 9:127276246-127276268 CTGTAATCCCAGCCTTGCCTTGG - Intronic
1060989864 9:127842349-127842371 CTGTAATCCCAGCTGTACTTGGG - Intronic
1061334316 9:129921335-129921357 CTGTAGTCCTAGCGGAGGCTGGG - Intronic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1062223746 9:135436796-135436818 CTGTAATCCCAGCTACTACTAGG + Intergenic
1062283202 9:135761123-135761145 CTGTAATCCCAGCTATTTCTGGG - Intronic
1062495517 9:136829761-136829783 CTGAAAACCCATCTGAGACTTGG + Intronic
1062627100 9:137448298-137448320 CTGTGTTCCCAGCTGAGGGAGGG - Exonic
1185703636 X:2250232-2250254 CTGTAATCCCAGCAGAACTTTGG + Intronic
1186141490 X:6579202-6579224 CTGTAATCCCAGCTAACGGGAGG - Intergenic
1186159494 X:6761927-6761949 CTGTAATCCCAGCACAGGTGTGG + Intergenic
1187346672 X:18471641-18471663 CTGTAATCCCAGCTAAGGTAGGG - Intronic
1187475641 X:19608428-19608450 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1187888726 X:23913634-23913656 CTGTAATCCCAGCGTGAGCTGGG + Intronic
1188645616 X:32563215-32563237 CTGTAGTCCCAGCTGCTACTTGG + Intronic
1189117727 X:38360041-38360063 CTGTAATCCCAGCTACTCCTTGG - Intronic
1189343160 X:40219906-40219928 CAGTGGTCACAGCTGAGGCTAGG - Intergenic
1189820694 X:44867868-44867890 CTGTAATCCCAGCTACTACTTGG - Intergenic
1190196200 X:48320760-48320782 CTATAGTCCCAGCTGAGTCTGGG - Intergenic
1190864819 X:54375621-54375643 CTGTAATCCCAGCTGCTCCGGGG - Intergenic
1192447560 X:71222359-71222381 CTGTAATCCCAGCTGCTGGGTGG - Intronic
1192479484 X:71472473-71472495 CTGTAATCCCAGCACAGGGGAGG + Intronic
1192770504 X:74184763-74184785 CTGTGATCTTACCTGAGGCTTGG - Intergenic
1192868570 X:75163058-75163080 CTGCAATCTCATCTGAGACTTGG + Intergenic
1193539378 X:82753141-82753163 CTGTAATCCCAGCTTTGGGGAGG - Intergenic
1193881289 X:86924687-86924709 CTGTGATCTCATCTGAGTCTTGG + Intergenic
1194048989 X:89044550-89044572 CTGTAATCCCAGCATATGTTAGG - Intergenic
1194554871 X:95344340-95344362 GTGTCATCCTAGCTGAGTCTTGG + Intergenic
1194688280 X:96951586-96951608 CTGTAATCCCAGCTACTCCTTGG - Intronic
1194908580 X:99610191-99610213 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1195656508 X:107336526-107336548 CTGCAAGCCCAGCTGAAGTTAGG + Intergenic
1196815780 X:119664716-119664738 CTGTAATCCCAGCTACGGAAAGG + Intronic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1198179764 X:134194919-134194941 TTGTAATCCCAGCTGCTACTCGG + Intergenic
1198532511 X:137560211-137560233 CTGTAGTGTCAGCAGAGGCTAGG - Intergenic
1200013616 X:153140709-153140731 CTGGAAACTTAGCTGAGGCTGGG + Intergenic
1200025985 X:153259209-153259231 CTGGAAACTTAGCTGAGGCTGGG - Intergenic
1200926368 Y:8658535-8658557 CAGAACTCACAGCTGAGGCTTGG - Intergenic
1201784690 Y:17761790-17761812 CTGTAATCCCAACCAAGGATCGG - Intergenic
1201816862 Y:18144197-18144219 CTGTAATCCCAACCAAGGATCGG + Intergenic