ID: 979664193

View in Genome Browser
Species Human (GRCh38)
Location 4:123293011-123293033
Sequence AGATTGCTTTCGTGCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664193_979664199 30 Left 979664193 4:123293011-123293033 CCAGACCAGCACGAAAGCAATCT 0: 1
1: 1
2: 4
3: 27
4: 96
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664193_979664198 11 Left 979664193 4:123293011-123293033 CCAGACCAGCACGAAAGCAATCT 0: 1
1: 1
2: 4
3: 27
4: 96
Right 979664198 4:123293045-123293067 ACACTCATGTCGCAATGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664193 Original CRISPR AGATTGCTTTCGTGCTGGTC TGG (reversed) Intronic
900990337 1:6095694-6095716 CGACTGCTTTGGTGCTGGGCAGG + Intronic
903777625 1:25802986-25803008 AGGTTGGTTCCGTGCTGGCCCGG + Intronic
908520591 1:64937363-64937385 AAATTTCTATGGTGCTGGTCAGG - Intronic
912308411 1:108594961-108594983 ATATTTCTTTCCTGCTTGTCTGG + Intronic
918093246 1:181315257-181315279 AGGGTGCTTTCTTGCAGGTCTGG + Intergenic
918199863 1:182256978-182257000 AGATTGCTTACAGGCTGGCCAGG - Intergenic
1065125214 10:22567514-22567536 AGAGTGCGTTCCTGCGGGTCAGG - Intronic
1065355396 10:24835427-24835449 AGATTGCTTTCCTGCTGGCCTGG + Intergenic
1068514609 10:58010294-58010316 AGATTGCTTTCAAGAGGGTCAGG - Intergenic
1070457575 10:76632551-76632573 AGGTTGCTATCGTTGTGGTCTGG - Intergenic
1071359725 10:84833944-84833966 AGATTGCTTTCTTACAGTTCTGG - Intergenic
1071880903 10:89897430-89897452 AGCTTGCTTTCCTGCTGGCCTGG - Intergenic
1075007560 10:118841747-118841769 AGATTGCTTTTGTGCTGCGACGG - Intergenic
1079102436 11:17549938-17549960 AGATTGGTTGCCTACTGGTCTGG - Intronic
1079974531 11:27075569-27075591 GGATTGCTTTCCTGCTGGCCTGG - Intronic
1080978067 11:37365669-37365691 GGATTGCTTTTCTACTGGTCTGG + Intergenic
1082357092 11:51595069-51595091 AGAATGCTTCCGTGCAGTTCTGG - Intergenic
1082382767 11:51968401-51968423 AGAATGCTTTCGTGTAGTTCTGG - Intergenic
1082456191 11:53031943-53031965 AGAATGCTTCCGTGTTGTTCTGG - Intergenic
1082461827 11:53113548-53113570 AGAATGCTTTCGTGTAGTTCTGG - Intergenic
1082465136 11:53161157-53161179 AGAATGCTTTCGTGTAGTTCTGG - Intergenic
1082470036 11:53231935-53231957 AGAATGCTTTCGTGTAGTTCTGG - Intergenic
1082509592 11:53803330-53803352 AGAATGCTTCCGTGCAGTTCTGG - Intergenic
1082512616 11:53846702-53846724 AGAATGCTTCCGTGTTGTTCTGG - Intergenic
1082523155 11:53999231-53999253 AGAATGCTTCCGTGTTGTTCTGG - Intergenic
1082526564 11:54048359-54048381 AGAATGCTTCCGTGCAGTTCTGG - Intergenic
1082527255 11:54058565-54058587 AGATTGCTTCCGTGTAGTTCTGG - Intergenic
1082541545 11:54265351-54265373 AGAATGCTTTCGTGTAGTTCTGG - Intergenic
1083923014 11:65790508-65790530 AGATCTCTTTCCAGCTGGTCAGG + Intronic
1086575127 11:88331142-88331164 TGATTGCTTGCTTGCTGGTGGGG - Intronic
1087364424 11:97201252-97201274 AAATTGCTTTCCTGCTGATCTGG - Intergenic
1087572562 11:99948448-99948470 AGCCTGCTTTTGTTCTGGTCTGG + Intronic
1088414000 11:109568995-109569017 AGATAGCTTTCCTGCTGGCCTGG - Intergenic
1091343275 11:134836400-134836422 AACTTGCTTTCGTGATGGGCTGG - Intergenic
1097906985 12:64930839-64930861 GGATAGCTTTCCTGCTGGCCTGG - Intergenic
1098520670 12:71432010-71432032 AGATGGCTTTCCTGCTGGCCTGG + Intronic
1099534254 12:83826054-83826076 AGATTCCTTTCCTGCTGGCCTGG - Intergenic
1103973326 12:124686161-124686183 AGATTGCAGTCGTGATAGTCAGG + Intergenic
1108252743 13:48583255-48583277 TGATTGCTTGCTTGCTGGTGGGG - Intergenic
1108273108 13:48782623-48782645 AGATTGTTTTCCTGCTAGCCTGG - Intergenic
1109263273 13:60167917-60167939 TGATTGCTTGCTTGCTGGTGGGG + Intergenic
1109504889 13:63287224-63287246 AGATAGCTTTCCTGCTAGCCTGG - Intergenic
1111108396 13:83675173-83675195 AGCCTGCTTTCTTGCTGCTCAGG + Intergenic
1123479807 15:20620485-20620507 AGATTGCTGTTGTGTTGGTGTGG + Intergenic
1123638200 15:22379879-22379901 AGATTGCTGTTGTGTTGGTGTGG - Intergenic
1128772623 15:70293754-70293776 AGTTTGCTCTAGTCCTGGTCTGG - Intergenic
1129179968 15:73867781-73867803 AGATTGATTTCATGCTGTTTTGG + Intergenic
1132039461 15:98512844-98512866 AGTTTTCTTTGGTGCTGCTCAGG - Intronic
1133709715 16:8389623-8389645 AGATTGCCTTCTTTCTGCTCAGG - Intergenic
1137264522 16:46857983-46858005 AGTTTGCTTTGAGGCTGGTCTGG - Intergenic
1137338092 16:47571444-47571466 AGGTTGCTTTCCTGCTGGCCTGG - Intronic
1138780236 16:59775838-59775860 TGATTGCTTGCTTGCTGGTGGGG + Intergenic
1155440228 18:25854608-25854630 AAAATGCTTTTGTGCTGGTTAGG + Intergenic
1160124846 18:76162555-76162577 GGATTTCTTTCTTGCTGTTCTGG - Intergenic
1163709960 19:18840534-18840556 AGAGTGCTTTCATGGTGGTCGGG + Intronic
1165551393 19:36589397-36589419 TGATTGCTTGCTTGCTGGTAGGG + Intronic
925637844 2:5959429-5959451 GGATTGCTTTCCTGCTGGCCTGG - Intergenic
926990607 2:18676223-18676245 TGATTGCTTTCTTGCTGGTCTGG - Intergenic
927099551 2:19777418-19777440 AGATAGCTTTGGGGCTGGTGGGG - Intergenic
927127325 2:20023990-20024012 AGATTTCTTTCATGCCTGTCTGG - Intergenic
928480076 2:31674797-31674819 AGATTGCTTTCCTGCTGGCCTGG - Intergenic
938736745 2:134192367-134192389 AGATTTATTTCTTGCAGGTCTGG - Intronic
940131348 2:150386838-150386860 GGATTGCTTTCCTGCTGGCCTGG - Intergenic
942073471 2:172336053-172336075 AAATGACTTTCATGCTGGTCTGG + Intergenic
946090873 2:217222089-217222111 AGATTGTTTTCCTGCTAGACTGG - Intergenic
1173103075 20:40105623-40105645 TGATTCCTTTTGTGCTGGGCAGG + Intergenic
1174268560 20:49350102-49350124 AGCTGGCATTTGTGCTGGTCTGG + Intergenic
1177249730 21:18577200-18577222 GGATAGCTTTCCTGCTGGTCTGG - Intergenic
1177303128 21:19276784-19276806 TGATTGCTTGCTTGCTGGTAGGG - Intergenic
1182989783 22:34756109-34756131 AGCCTGCGTTCCTGCTGGTCAGG + Intergenic
951391880 3:22114989-22115011 AGATTGATTTCTTGCAGTTCTGG - Intronic
951858931 3:27228838-27228860 GGATTCCTTTCCTGCTGGCCTGG + Intronic
954132588 3:48568053-48568075 AGATTGGTTTTTTTCTGGTCAGG - Intronic
955722129 3:61893861-61893883 ACATTTCTTTGGTGCTGGTCAGG + Intronic
956360557 3:68442258-68442280 AGAGGGCTTTCTTGCTGGTGGGG + Intronic
960761978 3:121081856-121081878 TGATAGCTTTCCTGCTAGTCTGG - Intronic
964635844 3:158858176-158858198 AGATTGCTTTCCTACTGGACTGG - Intergenic
964929143 3:161995074-161995096 AGATTGCTTTAGTTCAGATCAGG - Intergenic
970221806 4:13819323-13819345 AGATTGCTTAGGGGCTGGCCAGG + Intergenic
972213076 4:36862143-36862165 AGATTGCTTTTTTGCTGGCCTGG - Intergenic
975290854 4:72677241-72677263 GGATAGCTTTCCTGCTGGACTGG - Intergenic
976184578 4:82430897-82430919 CGATTGCTTTCGTGAAGGTGAGG + Exonic
977771853 4:100869678-100869700 GGATTGCTTTTCTGCTGGCCTGG - Intronic
979434772 4:120674798-120674820 GGATAGCTTTCCTGCTGGCCTGG + Intergenic
979664193 4:123293011-123293033 AGATTGCTTTCGTGCTGGTCTGG - Intronic
982187807 4:152820087-152820109 AGACTGCTTTCCTGCTGGCTTGG + Intronic
984600970 4:181726651-181726673 TGATTGCTTGCTTGCTGGTGGGG - Intergenic
984977791 4:185244991-185245013 TGATTGCATCTGTGCTGGTCTGG + Intronic
994804606 5:104428252-104428274 ACAATGCTTTCGTGATGGTTTGG + Intergenic
999115814 5:149162546-149162568 AGGTTTCTTTCTTTCTGGTCTGG - Intronic
999930758 5:156431135-156431157 GGATAGCTTTCCTGCTGGCCTGG - Intronic
1006011088 6:31043623-31043645 AGACTGGTTTTGTGTTGGTCAGG - Intergenic
1006272129 6:32972737-32972759 AGACTGCTTTCGTGCCGGCCAGG + Exonic
1006874042 6:37279920-37279942 ACATTGCTTTAGGCCTGGTCAGG + Intronic
1009614879 6:65991171-65991193 GGATTGTTTTCTTGCTGGTTTGG + Intergenic
1010015479 6:71101208-71101230 AGATAGCTTTCCTGCTGGCCTGG - Intergenic
1011394635 6:86892892-86892914 AGATAGCTTTCCTGCTGATCTGG + Intergenic
1012203386 6:96434238-96434260 GGATAGCTTTCCTGCTGGCCTGG - Intergenic
1016984018 6:149880934-149880956 AGAAAGCATTCGTACTGGTCTGG - Intergenic
1020450339 7:8314737-8314759 AGATTGCTTTCCTGCTGGTCTGG - Intergenic
1021081574 7:16371047-16371069 AGATCGCTTTCCTGCTGGCCTGG + Intronic
1027468819 7:78548398-78548420 AGATTGCTTTCATGTCGGCCAGG + Intronic
1027838532 7:83278249-83278271 AGATCACTTTCCTGTTGGTCTGG - Intergenic
1039820198 8:41128006-41128028 TGATTGCTTACTTGCTGGTGGGG + Intergenic
1041791126 8:61697361-61697383 TGATTGCTTACTTGCTGGTGAGG - Intronic
1042507410 8:69575587-69575609 AGATTGCATTTGTGCTGGGCTGG + Intronic
1044815468 8:96108134-96108156 ACAGTTCTTTCTTGCTGGTCGGG + Intergenic
1044880133 8:96715298-96715320 AGATTGCTTTCCTGCTGGCCTGG - Intronic
1048645174 8:136411880-136411902 AGATTGCTTCCATGCTCCTCTGG + Intergenic
1050476282 9:6044837-6044859 GGATAGCTTTCCTGCTGGACTGG - Intergenic
1055182089 9:73401385-73401407 GGATAGCTTTCCTGCTGGCCTGG - Intergenic
1055799931 9:80023615-80023637 TGATTGCTTTCTTGCTGGTAGGG + Intergenic
1058343061 9:103921379-103921401 AAATCGCTTTCCTGCTGATCTGG + Intergenic
1059360006 9:113734846-113734868 AGATTCCTTCTGTGTTGGTCTGG + Intergenic
1061368357 9:130184264-130184286 AGATGGCTTTTCTGGTGGTCTGG + Intronic
1203341275 Un_KI270418v1:541-563 AGAATGCTTTCGTGTAGTTCTGG + Intergenic
1189312452 X:40029253-40029275 TGATTGCTTGCTTGCTGGTGGGG + Intergenic
1191008497 X:55737186-55737208 AGATGGCTTTCCTGCTGGCCTGG - Intronic
1192221857 X:69202865-69202887 AGATTGCTTTGGGGATGGTTGGG + Intergenic
1192727128 X:73765313-73765335 AGATTGTTTTCTTGCTGGCCTGG - Intergenic
1192905448 X:75546106-75546128 AGATCGCTTTCCTGCTGGCCTGG - Intergenic
1193436468 X:81479636-81479658 AGATTGCTTTCCTGCTTGCCTGG + Intergenic
1194144083 X:90242076-90242098 GGATTGCTTTCCTGCTGTCCTGG + Intergenic
1194634139 X:96323064-96323086 AGATAGCTTTCCTGCTGGCCTGG - Intergenic
1197394258 X:125907097-125907119 GGATTGCTTTCCTGCTGGCCTGG - Intergenic
1198836790 X:140814676-140814698 GGATAGCTTTCCTGCTGGCCTGG - Intergenic
1199159017 X:144586202-144586224 AGATTGCTTTCCAGCTGGCCTGG - Intergenic
1199806238 X:151303245-151303267 AGAGTGCCTTCGTGCTTGCCTGG - Intergenic
1200489846 Y:3811377-3811399 GGATTGCTTTCCTGCTGTCCTGG + Intergenic