ID: 979664194

View in Genome Browser
Species Human (GRCh38)
Location 4:123293016-123293038
Sequence GAGGCAGATTGCTTTCGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 11, 3: 30, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664194_979664198 6 Left 979664194 4:123293016-123293038 CCAGCACGAAAGCAATCTGCCTC 0: 1
1: 1
2: 11
3: 30
4: 385
Right 979664198 4:123293045-123293067 ACACTCATGTCGCAATGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 106
979664194_979664199 25 Left 979664194 4:123293016-123293038 CCAGCACGAAAGCAATCTGCCTC 0: 1
1: 1
2: 11
3: 30
4: 385
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664194 Original CRISPR GAGGCAGATTGCTTTCGTGC TGG (reversed) Intronic
901709758 1:11104521-11104543 GGGGCAGATTGCTTGAGTCCAGG + Intergenic
902433396 1:16380988-16381010 GAGGCAGATCGCTTGAGTCCAGG + Intronic
903370867 1:22835149-22835171 CAGGCAGATTGCTTGAGTCCAGG + Intronic
903595714 1:24492717-24492739 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
903698340 1:25226529-25226551 GAGGCAGAATGCTTTAGTGCTGG - Intronic
903700535 1:25244909-25244931 GAGGCAGATGGCTTGAGTCCAGG - Intronic
904106052 1:28085221-28085243 CAGGCAGATTGCTTGAGTCCAGG + Intronic
904264150 1:29308339-29308361 CAGGCAGATTGCTTGAGTCCAGG + Intronic
904521120 1:31096784-31096806 CAGGAAGATTGCTTTAGTCCAGG - Intergenic
904522933 1:31110055-31110077 CAGGCAGATCGCTTTAGTCCAGG - Intergenic
904660195 1:32078254-32078276 CAGGCAGATTGCTTGAGTCCAGG + Intronic
905437249 1:37965524-37965546 CAGGCAGATTGCTTGAGTACAGG + Intronic
906012809 1:42544732-42544754 CAGGCAGATTGCTTGAGTCCAGG - Intronic
906341202 1:44982691-44982713 CAGGAGGATTGCTTTAGTGCAGG - Intronic
906548972 1:46645588-46645610 GAGGCAGATTGCTTGAGCCCGGG - Intronic
907757767 1:57327468-57327490 TTGGCAGATTGTTTTCTTGCAGG - Intronic
907790763 1:57661226-57661248 GAGGCAGATTGTTACAGTGCAGG + Intronic
907810853 1:57868333-57868355 TAGACTGATTTCTTTCGTGCTGG + Intronic
908732234 1:67238118-67238140 CAGGCAGATTGCTTGAGTCCAGG + Intronic
911393820 1:97279956-97279978 AAGGCACATTGCTTTCATGACGG + Intronic
911622269 1:100078840-100078862 CAGGCAGATTGCTTGAGTTCAGG + Intronic
911926772 1:103842684-103842706 CAGGCAGATTGCTTGAGTGCAGG + Intergenic
912477605 1:109949937-109949959 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
912912444 1:113775562-113775584 CAGGCAGATTGCTTGAGTCCAGG - Intronic
912928549 1:113934719-113934741 GAGGAGGATTGCTTTAGAGCAGG + Intronic
914450805 1:147789713-147789735 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
917066805 1:171104644-171104666 CAGGCAGATTGCTTGAGTCCAGG + Intronic
917644882 1:177020113-177020135 GAGGCAGATTGCTTGAGCCCAGG - Intronic
918093244 1:181315252-181315274 GAGCCAGGGTGCTTTCTTGCAGG + Intergenic
918534013 1:185554201-185554223 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
919430738 1:197488010-197488032 GAGGTGGATAGCTTTCCTGCAGG + Intergenic
919884543 1:201923634-201923656 GGGGCAGATTGCTTGAGTTCAGG + Intronic
921228350 1:213043329-213043351 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
921932462 1:220765807-220765829 CAGGCAGATTGCTTGAGTCCAGG - Intronic
922960114 1:229639084-229639106 GGGGCAGATTGCTTGAGTCCAGG + Intronic
924689356 1:246330905-246330927 CAGGCAGATTGCTTTAGCCCAGG + Intronic
1062807954 10:438716-438738 CAGGCAGATTGCTTGAGTCCTGG - Intronic
1063142322 10:3266207-3266229 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1063475525 10:6325189-6325211 GAGACAGATTGCTTGGGTCCAGG - Intergenic
1064746639 10:18484925-18484947 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1064849192 10:19691319-19691341 GAAGCTGATTGCTTTTGTGAAGG + Intronic
1065158251 10:22893291-22893313 GAGGTGTATTGCTTTCCTGCTGG - Intergenic
1065355395 10:24835422-24835444 GTGGTAGATTGCTTTCCTGCTGG + Intergenic
1066758312 10:38731634-38731656 GAGGCAGATTGCTTGAGGCCAGG + Intergenic
1067429222 10:46232032-46232054 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1067484355 10:46633537-46633559 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1067610406 10:47708109-47708131 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1067813441 10:49450096-49450118 GGGGCAGATTGCTTGAGTCCAGG - Intergenic
1068048921 10:51924054-51924076 GAGGAAGATTGCTTACATCCAGG - Intronic
1070447069 10:76515730-76515752 GCGGCAGATTGCTTGAGTCCAGG - Intronic
1071625815 10:87168367-87168389 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1072110792 10:92318197-92318219 CAGGCAGATTGCTTGAGTGCAGG + Intronic
1072359302 10:94643754-94643776 TAGGCAGATTGCTTAAGTCCAGG + Intergenic
1072704030 10:97667093-97667115 TAAGCAGATTGCTGTCATGCGGG + Exonic
1072788034 10:98297429-98297451 GAGGCAGTTTGCTTTAGTTCAGG + Intergenic
1073002166 10:100293877-100293899 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1073039429 10:100592102-100592124 CAGGCAGATCGCTTTAGTCCTGG + Intergenic
1074411389 10:113231508-113231530 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1074530109 10:114291236-114291258 GAGGCACATGGCTCCCGTGCAGG + Exonic
1076010904 10:126987285-126987307 GAGGTGGATGGCTTACGTGCAGG + Intronic
1078185583 11:9049471-9049493 CAGGCAGATTGCTTGAGTTCAGG - Intronic
1079974532 11:27075574-27075596 GAGGTGGATTGCTTTCCTGCTGG - Intronic
1080367488 11:31592314-31592336 CAGGCAGATTGCTTTAGCTCAGG + Intronic
1080596399 11:33777456-33777478 TAGGCAGATTGCTTGAGTCCAGG + Intergenic
1081858594 11:46319194-46319216 CAGGCAGATGGCTTTGGAGCAGG + Intronic
1081868171 11:46371162-46371184 GAGGCAGATTGCTTAAGCCCAGG + Intronic
1083016063 11:59455360-59455382 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1083115968 11:60460016-60460038 GGGGCAGATTGCTTGAGTCCAGG + Intronic
1083858980 11:65409542-65409564 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1084633715 11:70375558-70375580 TAGGCAGATTGCTTGAGTCCAGG + Intronic
1085551778 11:77380264-77380286 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1086614094 11:88794048-88794070 CAGGCAGATTGCTTTAGGCCAGG - Intronic
1087743710 11:101918218-101918240 TAGGCAGATTGCTTGAGTCCAGG + Intronic
1087792896 11:102425807-102425829 GAGGCAGATTGCTTGACTCCAGG - Intronic
1087979827 11:104597814-104597836 GAGGCAGATTGCTTCAGCCCAGG + Intergenic
1088312566 11:108475694-108475716 TAGGCAGATTGCTTGAGTCCAGG - Intronic
1088414001 11:109569000-109569022 GATGTAGATAGCTTTCCTGCTGG - Intergenic
1088463447 11:110107888-110107910 CAGGCAGATTGCTTTAGCTCAGG - Intronic
1089449811 11:118585764-118585786 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1090705512 11:129332823-129332845 CAGGCAGATTGCTTGGGTTCAGG + Intergenic
1090779951 11:129999048-129999070 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1091826351 12:3515681-3515703 GAAGCACATTGCTTTCCTGCAGG + Intronic
1093859478 12:24145732-24145754 GAGGCAGATTGCTTGCACTCAGG - Intergenic
1094197749 12:27767206-27767228 GAGGCAGATTGCTTGAGCTCTGG - Intronic
1096047804 12:48579696-48579718 GAGGCAGATAGCTTTTGTGGTGG - Intergenic
1096297188 12:50393617-50393639 CAGGCAGATTGCTTTAGCTCAGG + Intronic
1096320385 12:50607032-50607054 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1098140123 12:67442697-67442719 AAAGCAGATTGCTTTCTTCCTGG - Intergenic
1098182091 12:67858480-67858502 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1098242892 12:68486508-68486530 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1098520669 12:71432005-71432027 GAGGTAGATGGCTTTCCTGCTGG + Intronic
1099534255 12:83826059-83826081 GAGGCAGATTCCTTTCCTGCTGG - Intergenic
1100252940 12:92848948-92848970 CAGGCAGATTGCTTCAGTCCAGG - Intronic
1100319624 12:93478181-93478203 GAGGCAGATTGCTTGAGCTCAGG - Intronic
1100485304 12:95019544-95019566 GAGGCAGATTGCTTGAGTCCAGG - Intergenic
1100650567 12:96584234-96584256 GAGGCAGATTGCTTGAGGTCAGG + Intronic
1100790038 12:98120264-98120286 CAGGCAGATTGCTTGAGTACAGG - Intergenic
1101977363 12:109371443-109371465 CAGGCAGATTGCTTTAGCTCAGG - Intronic
1102343672 12:112143953-112143975 GGGGCAGATTGCTTGAGTTCAGG - Intronic
1103010228 12:117452635-117452657 CAGGCAGATTGCTTTAGCCCAGG - Intergenic
1103680816 12:122692216-122692238 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1103684752 12:122723144-122723166 GAGGCAGATTGCTGGAGTCCAGG + Intergenic
1105331612 13:19421896-19421918 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1105880166 13:24598640-24598662 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1105919666 13:24950226-24950248 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1106260914 13:28065907-28065929 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1107485311 13:40821068-40821090 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1107511017 13:41085006-41085028 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1108525175 13:51280416-51280438 GAGGCAGATCACATTAGTGCAGG - Intronic
1108818886 13:54321568-54321590 GAGGCAGATTGCTTTCCTATTGG + Intergenic
1109475118 13:62870907-62870929 GAGGCAGATTGCTGGAATGCAGG + Intergenic
1109869879 13:68320977-68320999 GAAGCAGATTGCATTTCTGCTGG - Intergenic
1110809697 13:79798202-79798224 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1113116367 13:106878621-106878643 TGGGCAGATTGCTTGAGTGCAGG - Intergenic
1113198378 13:107836216-107836238 GGGGCAGATTGCTTGAGTCCAGG - Intronic
1114518604 14:23318675-23318697 GAGCCAGATTGCTTGAGTCCAGG - Intronic
1114698081 14:24646125-24646147 GAGACAGATTGCTTTCCTGCTGG + Intergenic
1115253842 14:31377539-31377561 AAGGCAGATTGCTTAAGTCCAGG + Intronic
1115826814 14:37287854-37287876 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1116261804 14:42638502-42638524 GTGGCAGATTGCTTTTCTTCAGG - Intergenic
1116334615 14:43640799-43640821 GAGGTGGATAGCTTTCCTGCTGG + Intergenic
1118001628 14:61528419-61528441 CAGGCAGATTGCTTGAGTTCAGG - Intronic
1118195148 14:63618380-63618402 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1118394746 14:65326501-65326523 CAGGCAGATTGCTTAAGTCCAGG + Intergenic
1119005521 14:70924001-70924023 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1119506963 14:75181322-75181344 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1120207476 14:81602011-81602033 GAGGAAGATTGCTTTGGTACAGG - Intergenic
1120323281 14:82993115-82993137 GAGGCAGATTGCTGGGCTGCTGG + Intergenic
1121240093 14:92423370-92423392 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1121852401 14:97233787-97233809 CTGGCAGATTGCTTTAGTGTTGG + Intergenic
1122285483 14:100649278-100649300 GAGGCAAATTGCTCTCCAGCTGG - Intergenic
1125805867 15:42493112-42493134 GAGGCAGATCGCTTGAGTCCAGG + Intronic
1127924996 15:63530538-63530560 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1128022068 15:64400399-64400421 TGGGCAGATTGCTTGAGTGCAGG - Intronic
1128369170 15:67027063-67027085 CAGGCAGATTGCTTGCGGCCAGG + Intergenic
1129775161 15:78231814-78231836 AAGGAAGATTGCTTGAGTGCAGG - Intronic
1130073091 15:80665594-80665616 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1131154916 15:90068863-90068885 CAGGCAGATTGCTTGAGTCCTGG + Intronic
1131235049 15:90689177-90689199 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1133112370 16:3556099-3556121 CAGGCAGATGGCTTGAGTGCAGG + Intronic
1133982974 16:10647240-10647262 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1134028848 16:10975877-10975899 CAGGCAGATTGCTTTAGGTCAGG - Intronic
1134584792 16:15400575-15400597 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1135070949 16:19351128-19351150 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1135321262 16:21498658-21498680 TGGGCAGATTGCTTGCGTTCAGG + Intergenic
1135374095 16:21930160-21930182 TGGGCAGATTGCTTGCGTTCAGG + Intergenic
1135437691 16:22440561-22440583 TGGGCAGATTGCTTGCGTTCAGG - Intergenic
1135555520 16:23433195-23433217 CAGGAAGATTGCTTACGTCCAGG - Intronic
1135766881 16:25185602-25185624 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1136191737 16:28620335-28620357 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1136391195 16:29965489-29965511 CAGGCAGATTGCTTGAGCGCAGG + Intronic
1136424833 16:30162819-30162841 GAGGCAGATAGCTTGAGTTCAGG + Intergenic
1136719486 16:32309159-32309181 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1136724515 16:32347561-32347583 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1136837860 16:33515439-33515461 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1136842842 16:33553601-33553623 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1136996738 16:35195794-35195816 GCGGCAGATTACTTTCCTTCTGG - Intergenic
1137237639 16:46628456-46628478 GAGGCAGATTGCTTGAGGCCAGG + Intergenic
1137338093 16:47571449-47571471 CAGGGAGGTTGCTTTCCTGCTGG - Intronic
1138753464 16:59453291-59453313 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1139412917 16:66780092-66780114 CAGGCAGGTTGCTTTAGTTCAGG - Intronic
1139751637 16:69112480-69112502 GAGGCAGCCTCCTTTCCTGCAGG + Intronic
1140104742 16:71949578-71949600 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1203001915 16_KI270728v1_random:170194-170216 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1203006945 16_KI270728v1_random:208610-208632 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1203133519 16_KI270728v1_random:1706600-1706622 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1203148042 16_KI270728v1_random:1815723-1815745 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1203153007 16_KI270728v1_random:1853899-1853921 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1142629408 17:1214990-1215012 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1143605085 17:7979056-7979078 CAGGCAGATTGCTTGAGTGCAGG + Intergenic
1144337734 17:14286917-14286939 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1145746238 17:27322102-27322124 GGGGCAGATTGCTTGAGTCCAGG - Intergenic
1145929746 17:28676696-28676718 GTGGCAGATTGCTTGAGTCCAGG + Intronic
1146459412 17:33033668-33033690 GAGGCAGATTGATTCCTGGCAGG + Intronic
1146971488 17:37076196-37076218 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1147592674 17:41694905-41694927 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1147673770 17:42191390-42191412 GAGGCAGAGTGCTGTGGTCCTGG + Intronic
1147752952 17:42748229-42748251 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1148244785 17:46023610-46023632 CGGGCAGATTGCTTGCGTCCAGG + Intronic
1148529335 17:48374266-48374288 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1148811496 17:50295506-50295528 TAGGCAGATTGCTTGAGTTCAGG + Intergenic
1149791391 17:59480634-59480656 CAGGCAGATTGCTTTAGTCCAGG - Intergenic
1150707183 17:67497753-67497775 CAGGCAGACTGCTTGAGTGCAGG - Intronic
1150716980 17:67580566-67580588 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1151047096 17:70933478-70933500 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1152652434 17:81501200-81501222 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1153251847 18:3130681-3130703 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1154946666 18:21168530-21168552 CAGGCAGATTGCTTGTGTCCAGG - Intergenic
1154969449 18:21392998-21393020 GAGGCAGATCGCTTGGGTCCAGG - Intronic
1155122301 18:22834035-22834057 CAGGCAGATTGCTTGAGTCCTGG + Intronic
1155571633 18:27201078-27201100 CAGGCAGATTGCTTGAGTCCGGG - Intergenic
1156557080 18:38079576-38079598 GAAGCAGCTTGCCTTCATGCTGG + Intergenic
1157417512 18:47517738-47517760 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1157916303 18:51667105-51667127 GAGGCTGTTTGCTTTTGTGCTGG - Intergenic
1159030659 18:63227435-63227457 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1160824387 19:1072879-1072901 GAGGCAGTTTGCTTTCTGGAGGG + Intronic
1161107037 19:2449122-2449144 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1161940667 19:7401514-7401536 CAGGCAGATTGCTTGAGTTCAGG - Intronic
1162261092 19:9534820-9534842 CAGGCAGATTGCTTGAGTACAGG - Intronic
1162603046 19:11684348-11684370 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1162863778 19:13528188-13528210 CAGGCAGATTGCTTGAGTTCAGG - Intronic
1162869909 19:13578407-13578429 GAAGCTGATTGCTGTCATGCAGG - Intronic
1163383253 19:16982605-16982627 CAGGCAGATTGCTTGAGTTCAGG + Intronic
1164569459 19:29361246-29361268 GAGGCAGATTGCTTGAGATCAGG + Intergenic
1165477229 19:36038168-36038190 CAGGCAGATTGCTTGAGTTCGGG - Intronic
1165651513 19:37494985-37495007 GGGGCAGATTGCTTGAGTCCAGG - Intergenic
1166057650 19:40302515-40302537 GAAGCAGATTGCTTTAGTCTAGG - Intergenic
1166967356 19:46537324-46537346 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1167022914 19:46891911-46891933 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
1167848535 19:52184250-52184272 CAGGCAGATTGCTTGAGTCCGGG + Intergenic
1168013368 19:53552488-53552510 GAGGCAGATTGCTTGAGCTCAGG + Intronic
1168631224 19:57957842-57957864 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
925637845 2:5959434-5959456 GAGGTGGATTGCTTTCCTGCTGG - Intergenic
928480077 2:31674802-31674824 GAGGTAGATTGCTTTCCTGCTGG - Intergenic
929409415 2:41680206-41680228 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
930316441 2:49802076-49802098 TAGGGAGAATGCTTTTGTGCTGG + Intergenic
930815344 2:55591227-55591249 GAGGAAGATTGCTTGAGTCCAGG - Intronic
933359315 2:81258698-81258720 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
933672494 2:85022242-85022264 CAGGCAGATTGCTTGAGTCCAGG + Intronic
933970788 2:87468447-87468469 CAGGCAGATTGCTTGTGTCCAGG - Intergenic
934321627 2:91976074-91976096 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
934968535 2:98744137-98744159 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
935488136 2:103683649-103683671 GAGGCAGATTGCTTGAGTCCAGG - Intergenic
935754606 2:106267215-106267237 GAGGCAGATTGCTTGAGCTCAGG + Intergenic
936117722 2:109715333-109715355 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
936322942 2:111481748-111481770 CAGGCAGATTGCTTGTGTCCAGG + Intergenic
936927581 2:117753393-117753415 GAGGCAGTTTGCTGTGGTGCTGG - Intergenic
937902352 2:127030382-127030404 CAGGCAGATTGCTTGGGTCCAGG + Intergenic
938027068 2:127958884-127958906 CAGGCAGATTGCTTCAGTCCTGG - Intronic
938031997 2:128002897-128002919 CAGGCAGATTGCTTGAGTCCAGG + Intronic
938706661 2:133936628-133936650 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
939489511 2:142860314-142860336 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
940131349 2:150386843-150386865 GAGGTGGATTGCTTTCCTGCTGG - Intergenic
941152944 2:161938043-161938065 CAGGCAGATTGCTTTAGGCCAGG + Intronic
942840775 2:180358837-180358859 GAGGTGGATAGCTTTCATGCTGG - Intergenic
943174229 2:184448859-184448881 GAGGTATTTTGCTTTCCTGCTGG + Intergenic
943479002 2:188395200-188395222 GAGGTGGACTGCTTTCCTGCTGG - Intronic
943657375 2:190523973-190523995 CAGGCAGATTGCTTGAGTCCCGG + Intronic
944315758 2:198284247-198284269 CAGGCAGATTGCTTGAGTCCAGG + Intronic
944444896 2:199779599-199779621 GAGGCACATCGCTTTTTTGCAGG - Intronic
944551621 2:200849697-200849719 CAGGCAGATTGCTTGAGTCCGGG - Intergenic
945012675 2:205481777-205481799 GAGCCAGATTGCTTGGGTTCTGG - Intronic
945448379 2:209965207-209965229 CAGGCAGATTGCTTGAGTCCAGG + Intronic
946256701 2:218447545-218447567 CAGGCAGATTGCTTGAGTTCAGG - Intronic
949008398 2:241664299-241664321 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1168886498 20:1262956-1262978 GAGGCAGATTGCTTGAGCCCAGG - Intronic
1169015147 20:2286048-2286070 GAGGAAGATTGCTTGAGTCCAGG - Intergenic
1171252870 20:23662783-23662805 GAAGCAGGTGGATTTCGTGCTGG + Intergenic
1173719266 20:45239175-45239197 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1173722441 20:45271278-45271300 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1175120415 20:56712213-56712235 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1176741383 21:10606679-10606701 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1177249731 21:18577205-18577227 GAGGTGGATAGCTTTCCTGCTGG - Intergenic
1177909423 21:27012370-27012392 TGGGCAGATTGCTTGAGTGCAGG + Intergenic
1178480448 21:32975614-32975636 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1179666438 21:42915961-42915983 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1180309887 22:11160033-11160055 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1180548364 22:16521843-16521865 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1181571549 22:23770492-23770514 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1182211086 22:28678459-28678481 GAGGCAGATTGCTTGAGCCCAGG - Intronic
949992309 3:9589812-9589834 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
950505002 3:13389106-13389128 TTGGCAGATTGCTCTTGTGCAGG - Intronic
950746144 3:15090980-15091002 GAGGCAAATTGCTTGAGTCCAGG + Intronic
951048926 3:18072632-18072654 GAGGCAGATTGCTTGAGCTCAGG - Intronic
951858930 3:27228833-27228855 GAGGTGGATTCCTTTCCTGCTGG + Intronic
952364423 3:32662429-32662451 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
952388625 3:32860945-32860967 CAGGCAGATCGCTTGAGTGCAGG + Intronic
953445983 3:42967152-42967174 CAGGCAGATCGCTTGAGTGCAGG - Intronic
954103191 3:48393694-48393716 CAGGCAGATCGCTTGAGTGCAGG + Intronic
954271428 3:49512738-49512760 GAGGCAGATTGCTTGAGCCCAGG + Intronic
954331676 3:49894333-49894355 CAGGCAGATTGCTTGAGTCCAGG + Intronic
955256782 3:57339840-57339862 CAGGCAGATTGCTTGAGTCCAGG + Intronic
955790292 3:62582216-62582238 CAGGCAGATTGCTTGAGTCCAGG + Intronic
959006422 3:101025714-101025736 GAGGCAGATTGCTTTCCTGCTGG - Intergenic
959924825 3:111909366-111909388 GAGGAAGATTGCTTGAGTCCAGG + Intronic
960253938 3:115490236-115490258 CAGGCACATTACTTTGGTGCAGG + Intergenic
960579517 3:119264084-119264106 CAGGCAGATTGCTTGAGCGCAGG + Intergenic
961183222 3:124892460-124892482 GAGGTAGATTGCTTGAGTCCAGG + Intronic
961684932 3:128623307-128623329 CAGGCAGATTGCTTGAGTCCAGG + Intronic
961782148 3:129326608-129326630 GCGGCAGATTGCTCTTGTGCAGG - Intergenic
963011867 3:140777599-140777621 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
963024879 3:140909822-140909844 GAGGAGGATTGCTTGAGTGCAGG - Intergenic
963094065 3:141516999-141517021 GAGGCAGGTGGATTTCCTGCAGG - Intronic
964635845 3:158858181-158858203 AAGGTAGATTGCTTTCCTACTGG - Intergenic
965909179 3:173750139-173750161 GAGGAAGATTGCTTTGGTACAGG - Intronic
966466817 3:180238443-180238465 GAGGCAGATTGCTTAAGGGGAGG + Intergenic
967710566 3:192702563-192702585 GAGGTAGATTGCTTGAGTCCAGG + Intronic
967833746 3:193943590-193943612 AAGGCAGATGGCTTTGGCGCAGG - Intergenic
967894037 3:194382802-194382824 GAGGCAGATGGGTTTCCAGCTGG + Intergenic
971594381 4:28509971-28509993 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
972540554 4:40035471-40035493 CAGGTGGATTGCTTGCGTGCAGG + Intergenic
972548683 4:40107301-40107323 GAGGCAGATTGCTTGAGCCCAGG - Intronic
975290855 4:72677246-72677268 GAGGTGGATAGCTTTCCTGCTGG - Intergenic
976731585 4:88267308-88267330 GATGCTGATTGCTTGGGTGCAGG + Intronic
977628494 4:99215572-99215594 CAGGAAGATTGCTTGAGTGCAGG - Intronic
977670445 4:99688968-99688990 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
978110987 4:104963891-104963913 GAGGCAGAGTGCTTGGGTGAAGG + Intergenic
978135584 4:105254637-105254659 CAGGCAGATTGCTTGAGTCCAGG - Intronic
978652220 4:111019560-111019582 TGGGCAGATTGCTTGAGTGCAGG + Intergenic
978938341 4:114406734-114406756 CAGGCAGATTGCCTGGGTGCAGG + Intergenic
979032283 4:115665388-115665410 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
979664194 4:123293016-123293038 GAGGCAGATTGCTTTCGTGCTGG - Intronic
980049557 4:128025363-128025385 CAGGCAGATTGCTTTAGCCCAGG - Intronic
980629880 4:135417321-135417343 CAGGCAGATTGCTTGAGTTCAGG + Intergenic
981474124 4:145171001-145171023 AAGGCAGAGTTCTTTCATGCAGG - Intronic
981697894 4:147577117-147577139 CAGGCAGATTGCTTGAGCGCAGG + Intergenic
981947487 4:150365232-150365254 CAGGCAGATTGCTTGAGTCCAGG - Intronic
982187806 4:152820082-152820104 GAGGTAGACTGCTTTCCTGCTGG + Intronic
983017129 4:162627813-162627835 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
983158327 4:164379756-164379778 CAGGCAGATTGCTTGAGTCCAGG + Intronic
983326080 4:166258667-166258689 GAGGCAGATTGCTTGTGTTTGGG + Intergenic
986916061 5:12622775-12622797 GAGGCATACTGCTTTCCTTCTGG - Intergenic
987030705 5:13974350-13974372 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
988228293 5:28442990-28443012 AAGGCAGATTGCCTTCCTACTGG - Intergenic
988507120 5:31833239-31833261 TAGGCAGATTGCTTGAGTCCAGG + Intronic
988570862 5:32364493-32364515 GAGGCAGATTGCCTGAGTTCAGG + Intronic
991691144 5:69225956-69225978 CAGGCAGATTGCGTGAGTGCAGG - Intronic
993171862 5:84430118-84430140 GAAGCAGATTGCTTTCCTGCTGG - Intergenic
994812384 5:104538083-104538105 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
995115464 5:108473172-108473194 GAGGCAGACTGCTTTCCTGCTGG + Intergenic
997671537 5:135679014-135679036 CAGGCAGCTTGCTTGGGTGCTGG + Intergenic
998187875 5:139996911-139996933 GGGGCAGATTGCTTGAGTCCAGG + Intronic
998508557 5:142692101-142692123 CAGGCAGATTGCTTGAGTCCAGG + Intronic
999799451 5:155019658-155019680 GAGGCAGATTGATTCCTTGGCGG - Intergenic
999930759 5:156431140-156431162 GAGGTGGATAGCTTTCCTGCTGG - Intronic
1001061984 5:168499088-168499110 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1005384011 6:25267980-25268002 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1005975488 6:30795066-30795088 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1006490892 6:34386884-34386906 GATGCAGATTGCCTTAGTCCAGG + Intronic
1006912566 6:37572861-37572883 CAGGCAGATTGCTTTAGCCCAGG - Intergenic
1007511655 6:42378886-42378908 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1009624723 6:66125461-66125483 GAGGCTGATTGGTTTTCTGCTGG - Intergenic
1010015480 6:71101213-71101235 GAGGTAGATAGCTTTCCTGCTGG - Intergenic
1012203387 6:96434243-96434265 GAGTCGGATAGCTTTCCTGCTGG - Intergenic
1012496268 6:99836604-99836626 CAGGCCGATTGCTTGAGTGCAGG - Intergenic
1013105111 6:107020487-107020509 GCGGCAGATTGCTTGAGTTCAGG + Intergenic
1013786116 6:113783140-113783162 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1015895452 6:138012359-138012381 CAGGCAGATTGCTTGGGTCCAGG + Intergenic
1019024245 6:168943834-168943856 GATGCAGATTGCATTCTTGCAGG - Intergenic
1019092478 6:169550941-169550963 TAGGCAGATTGCTTCAGTCCAGG - Intronic
1019722470 7:2581611-2581633 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1020450340 7:8314742-8314764 AAGGCAGATTGCTTTCCTGCTGG - Intergenic
1020535571 7:9391910-9391932 CAGGCAGATTGCTTTAGTCCAGG + Intergenic
1021081573 7:16371042-16371064 GAGGTAGATCGCTTTCCTGCTGG + Intronic
1021397541 7:20168690-20168712 GAGGCAGATAGCTGTCTAGCTGG - Intronic
1021499459 7:21314674-21314696 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1022394133 7:29970376-29970398 CAGGCAGATTGTTTTGGTACAGG - Intronic
1022565772 7:31399482-31399504 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1022731719 7:33032682-33032704 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1022778352 7:33551867-33551889 GAGACAGATTCCTTTTGTGATGG + Intronic
1023065279 7:36371338-36371360 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1023383832 7:39635120-39635142 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1024556598 7:50608735-50608757 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1025973945 7:66354765-66354787 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1026025838 7:66742832-66742854 CAGGAAGATTGCTTGAGTGCAGG - Intronic
1026685060 7:72502923-72502945 GAGGCAGATTGCTTGAGGTCAGG + Intergenic
1026897213 7:74016717-74016739 GAGGCAGATTGCTTGAGGTCAGG - Intergenic
1027520156 7:79197006-79197028 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1028927641 7:96376774-96376796 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1031248048 7:119342055-119342077 TAGGCAGAGTGCGTTGGTGCAGG - Intergenic
1031844686 7:126790926-126790948 GAGTCAGATGTCTTTCCTGCGGG + Intronic
1032558214 7:132860041-132860063 GAGGCAGATTGCTTGGGCCCGGG + Intronic
1032746181 7:134788785-134788807 CAGGCAGATTGCTTAAGGGCAGG + Intronic
1032907099 7:136381010-136381032 TAGGCAGATTGCTTGAGTCCAGG + Intergenic
1033068238 7:138176766-138176788 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1033161401 7:139000393-139000415 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1034118024 7:148601572-148601594 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1034785465 7:153922271-153922293 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1036457263 8:8920693-8920715 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1036816159 8:11904449-11904471 CAGGCAGATTGCTTGAGTTCAGG - Intergenic
1038172980 8:25155044-25155066 GAGGCAGATTGCTTGAGCGCAGG + Intergenic
1038568835 8:28642214-28642236 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1038677691 8:29638243-29638265 TGGGCAGATTGCTTGAGTGCAGG + Intergenic
1038800174 8:30742567-30742589 GAGGCAGATTGCTTCAGCTCAGG - Intronic
1038831196 8:31062638-31062660 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1042002732 8:64144580-64144602 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1042647312 8:71001488-71001510 GAGGCAGATTGCTTGAGCCCAGG - Intergenic
1043403948 8:79911715-79911737 GGGGCAGATTGCTTGAGTTCAGG + Intergenic
1044880134 8:96715303-96715325 GAGGTAGATTGCTTTCCTGCTGG - Intronic
1044993596 8:97818038-97818060 CAGGCAGATTGCTTGAGTGCAGG - Intronic
1045049868 8:98313548-98313570 GAGGCAGAATGCCCTCCTGCTGG - Intergenic
1045097647 8:98814907-98814929 CAGGCAGATTGCTTTAGTCTAGG - Intronic
1045359823 8:101422601-101422623 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1045492989 8:102684567-102684589 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1046986061 8:120390362-120390384 GAGGAGGATAGCTTTCCTGCGGG - Intronic
1047346361 8:124032499-124032521 GGGGCAGATTGCTTTAGTCCAGG + Intronic
1050545517 9:6705514-6705536 GAGGCAGATTGCTTGAGGTCAGG + Intergenic
1051654842 9:19369537-19369559 GAGGCAGATTGCTTGAGCCCAGG + Intronic
1051796320 9:20875409-20875431 GAGGCAGATTGCTTGAGGTCAGG + Intronic
1053448492 9:38172312-38172334 GTGGCAGGTTTCTTTCCTGCAGG - Intergenic
1055182090 9:73401390-73401412 GAGGTGGATAGCTTTCCTGCTGG - Intergenic
1055571446 9:77621159-77621181 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1055802989 9:80060843-80060865 TAGGCAGATTGCTTGAGTCCAGG - Intergenic
1058532947 9:105925025-105925047 GAGGCAGATGGGTTTACTGCTGG + Intergenic
1058739671 9:107930547-107930569 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1059464066 9:114455481-114455503 GAGGCAGATTGCTTGAGCCCAGG + Intronic
1060255006 9:122019676-122019698 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1061197784 9:129117272-129117294 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1061362862 9:130154863-130154885 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1061806844 9:133141589-133141611 GAGGCAGGTGGCTTTGGAGCAGG - Intronic
1062552242 9:137094510-137094532 CAGGCAGATTGCTTGAATGCAGG + Intronic
1186119789 X:6348033-6348055 AAGGCAGATTGCTTGAGTCCAGG - Intergenic
1186243869 X:7599526-7599548 GGGGCAGATTGCTTGAGTCCAGG - Intergenic
1186428763 X:9486459-9486481 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1186798423 X:13068645-13068667 GAGGTAGAATGGTTTCTTGCTGG - Intergenic
1188040899 X:25369211-25369233 CAGGCAGCTTGCTTGGGTGCTGG + Intergenic
1188060071 X:25590373-25590395 CAGGCAGATTGCTTGGGTGAAGG + Intergenic
1188244496 X:27823703-27823725 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1188491013 X:30739099-30739121 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1188984247 X:36755253-36755275 CAGGCAGATTGCTTTAGCCCAGG - Intergenic
1189488812 X:41453681-41453703 CAGGCAGATTGCTTGAGTCCAGG - Intronic
1189855913 X:45224621-45224643 CAGGCAGATTGCTTGAGTCCAGG - Intergenic
1190261370 X:48799662-48799684 CAGGCAGATTGCTTGAGTCCAGG + Intergenic
1191008498 X:55737191-55737213 GAAGCAGATGGCTTTCCTGCTGG - Intronic
1192345113 X:70296310-70296332 CAGGCAGATTGCTTTAGCTCAGG - Intronic
1192355977 X:70404331-70404353 CAGGCAGATTGCTTGAGTCCAGG + Intronic
1192682775 X:73268797-73268819 GAGGCAGATTGTTTTCCTGCTGG + Intergenic
1192727129 X:73765318-73765340 GAGGCAGATTGTTTTCTTGCTGG - Intergenic
1192905449 X:75546111-75546133 GAGGTAGATCGCTTTCCTGCTGG - Intergenic
1194634140 X:96323069-96323091 GATGTAGATAGCTTTCCTGCTGG - Intergenic
1195701869 X:107711784-107711806 GAGGCAGGTTGCTTGAGTCCAGG + Intergenic
1195869794 X:109474027-109474049 GAGGCAGATTACTGTAGTTCTGG + Intronic
1197832666 X:130661414-130661436 CAGGCAGATTGCTTGAGTTCAGG - Intronic
1197912046 X:131493203-131493225 GTGGCAGGTTGCTTCCCTGCAGG + Intergenic
1198868159 X:141147713-141147735 GAGGCAGATTGCTTGAGCTCAGG + Intergenic
1199159018 X:144586207-144586229 GAGGCAGATTGCTTTCCAGCTGG - Intergenic
1201189117 Y:11431200-11431222 GAGGCAGATTGCTTGAGCCCAGG + Intergenic
1202599703 Y:26580831-26580853 CAGGCAGATTGCTTGAGTTCAGG - Intergenic