ID: 979664195

View in Genome Browser
Species Human (GRCh38)
Location 4:123293035-123293057
Sequence GCGACATGAGTGTGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664195_979664199 6 Left 979664195 4:123293035-123293057 CCTCCCTGTCACACTCATGTCGC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664195_979664200 17 Left 979664195 4:123293035-123293057 CCTCCCTGTCACACTCATGTCGC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 979664200 4:123293075-123293097 GATCAGACGAGGCACTTCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664195 Original CRISPR GCGACATGAGTGTGACAGGG AGG (reversed) Intronic
900986595 1:6076735-6076757 CCCAGATGAGGGTGACAGGGAGG + Intronic
901642042 1:10697556-10697578 GCGATAGCAGTGTGACAGGAAGG - Intronic
906177340 1:43785957-43785979 GGGACATGAGTGAGACAGGAAGG - Intronic
906691170 1:47793533-47793555 GCGGCATGAGGGTGACAGGAGGG + Intronic
920671691 1:208008583-208008605 GAGAGATGAGAGTGACAGTGGGG - Intergenic
921031003 1:211335161-211335183 AAGACGTGAGTGTGACATGGTGG + Intronic
1064585624 10:16836994-16837016 GAGACATTCCTGTGACAGGGAGG - Intronic
1064714951 10:18167145-18167167 GCGACATGAGTGGAACTGGAGGG + Intronic
1065158252 10:22893310-22893332 GGGTCAGGAGTGTGACTGGGAGG - Intergenic
1067323398 10:45243902-45243924 GAGACATACTTGTGACAGGGAGG - Intergenic
1068883722 10:62076942-62076964 GGGAGATGAGAGTGGCAGGGTGG - Intronic
1073996772 10:109324573-109324595 GTGACATGAGTGAGACTGGGAGG - Intergenic
1077613830 11:3661095-3661117 GAGAGGTGAGTGTGGCAGGGAGG + Intronic
1079137566 11:17784588-17784610 GTGCCATGAATGTGACAGGAGGG + Intergenic
1079974534 11:27075593-27075615 GGGTCAGGAGTGTGACTGGGAGG - Intronic
1083475146 11:62910485-62910507 TGCACATGACTGTGACAGGGAGG + Exonic
1084032710 11:66490509-66490531 GAGACAAGAGGGTGACTGGGAGG - Intronic
1085454632 11:76658842-76658864 GCAACATGAGAGTGCCAGGAAGG + Exonic
1086399438 11:86448428-86448450 GGGACATAAGTGTGAGAGTGGGG + Intronic
1088609809 11:111566300-111566322 CAGACATGAGAGTCACAGGGAGG + Intergenic
1089292029 11:117443314-117443336 GGGACATGGGTGTGCCATGGGGG - Intronic
1091061359 11:132466096-132466118 TCCACATGAGTCTGAAAGGGAGG - Intronic
1091997940 12:5009944-5009966 GGGACATTTGTGGGACAGGGAGG - Intergenic
1093707997 12:22296465-22296487 GAGACAAGAGTGAGAGAGGGTGG - Intronic
1095398251 12:41785909-41785931 GAGTTATGACTGTGACAGGGAGG + Intergenic
1095939722 12:47718062-47718084 GGGACATGAGGGTGACAAGCAGG - Intronic
1096186789 12:49586853-49586875 GAGACCTCAGTGAGACAGGGAGG - Intronic
1096545707 12:52338710-52338732 GCGACATGACAGTGAAAGGAGGG - Intergenic
1097138778 12:56881625-56881647 GAGACATCAGTGTCACACGGTGG + Intergenic
1109778567 13:67077229-67077251 GAGAAAAGAGAGTGACAGGGAGG - Intronic
1114071541 14:19112978-19113000 ACCACATGAGTGTGAAAGGGAGG - Intergenic
1114090720 14:19286990-19287012 ACCACATGAGTGTGAAAGGGAGG + Intergenic
1116274335 14:42811159-42811181 GGGACAAGAGTGTGTCTGGGAGG - Intergenic
1118286044 14:64474136-64474158 GCAACATGAGTGGCACAGAGGGG + Exonic
1120235272 14:81883189-81883211 GTGACAAGACTGTGACAGAGGGG - Intergenic
1131401145 15:92126490-92126512 GCGATGTGAGTCTGCCAGGGAGG - Intronic
1135407316 16:22207295-22207317 GCGCCCTGAGTGTGACAGATGGG + Intronic
1139170447 16:64625159-64625181 GGGTCAGGAGTGTGACAGGGAGG - Intergenic
1149407872 17:56373077-56373099 GCTAGATGAGTGTGACATGGTGG - Intronic
1150158808 17:62876389-62876411 CAGACATGAGGGTGACAGTGAGG - Intergenic
1151893361 17:76964110-76964132 GCTCCATGAGGGTGACATGGTGG + Intergenic
1153288920 18:3481428-3481450 GCGACAAGAGTGAGACAGCGAGG - Intergenic
1154385522 18:13888550-13888572 GTGAAAGGAGTGTGACATGGTGG - Intronic
1155175821 18:23300169-23300191 AAGACATGACTGTGAAAGGGAGG + Intronic
1158203729 18:54967862-54967884 GCGACAGGAGAGAGAGAGGGAGG + Intergenic
1159870608 18:73756717-73756739 GCGACAAGAGTGAGTCAGCGGGG + Intergenic
1163709011 19:18834261-18834283 GAGCCATGAGCGTGACAGCGCGG + Intronic
1164781055 19:30893208-30893230 GAGACATGAGTCTGCCATGGTGG + Intergenic
1165966199 19:39582969-39582991 GAGACCTGAGGATGACAGGGAGG - Intergenic
1168226120 19:54996654-54996676 CGGGCATGAGTGAGACAGGGAGG - Intronic
927452674 2:23222447-23222469 GCAGCATGTGTGTGACAGTGAGG - Intergenic
929390072 2:41459417-41459439 GAGACATCAGTGTGCCAGGGAGG - Intergenic
935269701 2:101423347-101423369 GCAGCATGAGTGACACAGGGAGG - Intronic
935911592 2:107902133-107902155 GTGAGATGTGTGTGACAGTGTGG - Intergenic
936885688 2:117308321-117308343 GAGTCAGGAGTGTGACTGGGAGG - Intergenic
936890249 2:117360698-117360720 GGGACAGGAGTGTGACTGAGAGG + Intergenic
940271163 2:151891931-151891953 ATGACAGGTGTGTGACAGGGTGG + Intronic
940448339 2:153805576-153805598 CCTACATGAGTGTTACAAGGAGG + Intergenic
940455582 2:153894564-153894586 GAGAGATGGGGGTGACAGGGAGG + Intronic
940610796 2:155989050-155989072 GCGACATGAGAGTGTCAGGAGGG + Intergenic
942201266 2:173573774-173573796 GCTACTTGAGGGTGAGAGGGTGG - Intergenic
943967751 2:194359361-194359383 GCGACATGAGTGACCCAGGAGGG + Intergenic
946038397 2:216763092-216763114 GCCACATGAAGGTGAGAGGGAGG + Intergenic
1171989400 20:31684299-31684321 GAGGCATGAGTGTGCCAGGCTGG + Intronic
1172245470 20:33442933-33442955 GGGACACCAGTGGGACAGGGAGG - Intronic
1175329235 20:58151204-58151226 GGGACATGAGAGCGACAGGAGGG + Intronic
1175895485 20:62333944-62333966 GGGCCATGAGTGTGAGCGGGCGG - Exonic
1178952906 21:36999705-36999727 GAGACATGAATGTGCCTGGGAGG + Intergenic
1180107392 21:45629156-45629178 GGGAGAGGAGTGGGACAGGGCGG + Intergenic
1180489984 22:15835310-15835332 ACCACATGAGTGTGAAAGGGAGG - Intergenic
1182769164 22:32781283-32781305 GCACCATGAGGGTGAGAGGGAGG - Intronic
1184647361 22:45903516-45903538 GCCCCAGGAGTGTGGCAGGGAGG + Intergenic
954534881 3:51352388-51352410 GTGACATGAGCATGAAAGGGTGG - Intronic
956146896 3:66199387-66199409 TCAACATGAGAGTGACAGTGAGG - Intronic
958739305 3:98049403-98049425 GAGAGAGGAGTGTGAGAGGGAGG + Intergenic
960580416 3:119273488-119273510 GAGACATGGGGGTGAAAGGGAGG + Intergenic
961010684 3:123433765-123433787 GTGGCATAAGTGGGACAGGGAGG - Intronic
964412803 3:156416299-156416321 TCTACATGAGTCTGATAGGGTGG - Intronic
970801205 4:19975686-19975708 GGGACATGATTGAGACATGGTGG - Intergenic
972519562 4:39840773-39840795 GCGACAAGAGTGAGACTTGGTGG - Intronic
974978022 4:68916435-68916457 GCTCCAAGAGTGTGACAGAGGGG - Intergenic
979664195 4:123293035-123293057 GCGACATGAGTGTGACAGGGAGG - Intronic
984500335 4:180550580-180550602 TAGACATGAGTGGGACATGGGGG - Intergenic
985991959 5:3569688-3569710 GTGCCGGGAGTGTGACAGGGTGG - Intergenic
995115463 5:108473153-108473175 GGGTCAGGAGTGTGACTGGGAGG + Intergenic
997867844 5:137480617-137480639 GGCCCATGAGTGTGACAGGGAGG + Intronic
1001423695 5:171608926-171608948 GTGACAGGAGTGTGACAAGCTGG - Intergenic
1002702783 5:181137841-181137863 GAGACCTGAGTGTGAGAGGGTGG + Intergenic
1003307493 6:4942933-4942955 GAGACAAGAGTGTCACAGGCTGG - Intronic
1004223617 6:13767669-13767691 GCCACATGACTGTCAGAGGGGGG - Intergenic
1006451829 6:34109822-34109844 ACCACATGACAGTGACAGGGAGG - Intronic
1014653204 6:124067181-124067203 GGGACATTAGTGTGACAGCTGGG + Intronic
1017391571 6:153945687-153945709 GAGATATGAGTGTGGAAGGGTGG + Intergenic
1018303571 6:162429634-162429656 GTGTCGTGGGTGTGACAGGGTGG - Intronic
1022059887 7:26783078-26783100 GGGACATGCGAGTGACAGTGTGG - Intronic
1022107783 7:27209232-27209254 GAGACTTGAGCATGACAGGGTGG + Intergenic
1023359958 7:39405850-39405872 GGGACAAGAGTGAAACAGGGAGG - Intronic
1029159388 7:98540957-98540979 GAGCCATGAATGTCACAGGGCGG + Intergenic
1032854289 7:135821480-135821502 GCGACATGAGTGAGATGGGGGGG - Intergenic
1033089480 7:138371814-138371836 GAGACATCAGTGCTACAGGGAGG - Intergenic
1049958713 9:717349-717371 ACCACAGGAGTGTGCCAGGGAGG - Intronic
1051438008 9:17053512-17053534 GCCACATGAGTGTTTCAGAGAGG + Intergenic
1053062882 9:35045248-35045270 GCCACAGGAGTCTGGCAGGGCGG + Exonic
1058618377 9:106860209-106860231 TCGAGGTGAGTGTGAAAGGGCGG + Intergenic
1059834041 9:118129776-118129798 GGGTCAGGAGTGTGACAAGGAGG + Intergenic
1062614596 9:137390707-137390729 GTGACATGAGGGTGACATGAGGG - Intronic
1186135482 X:6515886-6515908 GTGACATGAGTGGGTGAGGGAGG - Intergenic
1186371865 X:8955006-8955028 GTGACATGGGTGTCACAGAGTGG - Intergenic
1190398454 X:50008215-50008237 GAGAGAGGAGTGTGAAAGGGAGG - Intronic
1190639154 X:52466274-52466296 GGGGAATGAGTGTTACAGGGAGG - Intergenic
1192582814 X:72299182-72299204 GTGACAGGAGTGTGGCTGGGAGG - Intronic
1192682774 X:73268778-73268800 GTGACAGGAGTGTAACTGGGAGG + Intergenic
1192727130 X:73765337-73765359 GTGTCAGGAGTGTGACTGGGAGG - Intergenic
1193387042 X:80884372-80884394 GGGACAGGAGTGTGTCTGGGAGG + Intergenic
1198053050 X:132967181-132967203 GTGACAAGAGCGTGACATGGCGG + Intergenic
1199159019 X:144586226-144586248 GGGTCAGGAGTGTGACTGGGAGG - Intergenic
1200094692 X:153651810-153651832 GCATCCTGAGAGTGACAGGGAGG + Intergenic
1201759068 Y:17518483-17518505 GCCACCTGAGTGGGACAGGAGGG + Intergenic
1201842487 Y:18387507-18387529 GCCACCTGAGTGGGACAGGAGGG - Intergenic