ID: 979664196

View in Genome Browser
Species Human (GRCh38)
Location 4:123293038-123293060
Sequence ATTGCGACATGAGTGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664196_979664199 3 Left 979664196 4:123293038-123293060 CCCTGTCACACTCATGTCGCAAT 0: 1
1: 0
2: 2
3: 4
4: 85
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664196_979664200 14 Left 979664196 4:123293038-123293060 CCCTGTCACACTCATGTCGCAAT 0: 1
1: 0
2: 2
3: 4
4: 85
Right 979664200 4:123293075-123293097 GATCAGACGAGGCACTTCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664196 Original CRISPR ATTGCGACATGAGTGTGACA GGG (reversed) Intronic
907574559 1:55514417-55514439 AGTCCGCCATGAGTGTGAGAGGG + Intergenic
908269834 1:62411978-62412000 ATTGATACAGGAGTGCGACAGGG + Intergenic
912705685 1:111910353-111910375 ATTGGGACAGGAGTGTGAACTGG - Intronic
915006127 1:152638759-152638781 ATTGCAACATGAGTGTTGGAGGG - Intergenic
915538470 1:156552052-156552074 ATTGCGACAGGAGCGTGGGATGG - Exonic
918661618 1:187095178-187095200 AATGAGAAATGAGGGTGACAAGG - Intergenic
921031002 1:211335158-211335180 AGTAAGACGTGAGTGTGACATGG + Intronic
1064082239 10:12318138-12318160 ATTTCAACATGAGTCTGGCAGGG - Intergenic
1068569235 10:58610276-58610298 GTTGTGCCCTGAGTGTGACAGGG + Intronic
1074415328 10:113262372-113262394 TTTGCGAGATGAGTTTGAAATGG - Intergenic
1075594148 10:123715805-123715827 ATTGGGGCATAAGAGTGACATGG + Intronic
1085408178 11:76276430-76276452 ATTGCTAAGTGAATGTGACAGGG + Intergenic
1086258249 11:84906306-84906328 ATGGGCACATGTGTGTGACAGGG + Intronic
1089096159 11:115921804-115921826 ATTGAGTCAGGAGTGGGACAGGG + Intergenic
1089181638 11:116587288-116587310 ACAGAGACATGAGTGTGACCGGG + Intergenic
1093671250 12:21878679-21878701 ATAGCTTTATGAGTGTGACAGGG + Intronic
1095873213 12:47053051-47053073 ATTGTGACATGAGTGAGAAATGG + Intergenic
1103890444 12:124234811-124234833 ATTTCTTCATGAGTATGACAAGG - Intronic
1106862674 13:33927550-33927572 ATTGCTACATGAGTCACACATGG - Intronic
1107100931 13:36591507-36591529 ATTTCAACATGAGTTTGGCAAGG - Intergenic
1107294942 13:38898605-38898627 ATTGGGACCTGAGAGTCACATGG + Intergenic
1109739532 13:66534125-66534147 ATTGTTATATCAGTGTGACATGG - Intronic
1115079559 14:29434576-29434598 ATTTCCACATCAGTGTGATATGG + Intergenic
1116130325 14:40847930-40847952 ATTTCGACATGAGTTTGAGAAGG + Intergenic
1118455755 14:65944600-65944622 ATTTCAACATGAGTTTTACAGGG + Intergenic
1122441865 14:101737462-101737484 ATTTCGACATGAGTCTGGAAAGG + Intergenic
1129954560 15:79623601-79623623 ATTTCGTCATGATTGTGAAAAGG - Intergenic
1132744867 16:1432372-1432394 ATTGCCACAGGAGTGAGGCATGG - Intergenic
1139018818 16:62723363-62723385 ATTTCAACATGAGTGTTAGAAGG + Intergenic
1139170448 16:64625162-64625184 ACTGGGTCAGGAGTGTGACAGGG - Intergenic
1149407873 17:56373080-56373102 AGTGCTAGATGAGTGTGACATGG - Intronic
1149580418 17:57746353-57746375 ATTGCAACATGAGTTTGGGAGGG - Intergenic
1150981036 17:70141814-70141836 ATTTCTACATGAGTTTTACAAGG + Intergenic
1154385523 18:13888553-13888575 CTTGTGAAAGGAGTGTGACATGG - Intronic
1156563862 18:38161039-38161061 ATTGGGATGTGATTGTGACAAGG + Intergenic
1162265880 19:9573901-9573923 ATTGAGCCATGATTGTGCCACGG - Intronic
1164781054 19:30893205-30893227 ACTGAGACATGAGTCTGCCATGG + Intergenic
1166471529 19:43083098-43083120 AATGGGACATCACTGTGACAGGG - Intronic
925808149 2:7672831-7672853 ATTGTGTCATGAGTTTGAGATGG + Intergenic
926400277 2:12489542-12489564 ATGGCATCATGAGTGTGAAAGGG - Intergenic
927773918 2:25887426-25887448 AGTGCGCCATGAGTGGGCCATGG - Intergenic
929390073 2:41459420-41459442 ATTGAGACATCAGTGTGCCAGGG - Intergenic
929476406 2:42254399-42254421 AGTGAGCCATGATTGTGACATGG + Intronic
932113559 2:69023915-69023937 TTTGTAATATGAGTGTGACAGGG + Intronic
935503652 2:103872094-103872116 GTTGCCAAATGAGTGTGGCAAGG + Intergenic
940448337 2:153805573-153805595 AATCCTACATGAGTGTTACAAGG + Intergenic
941314335 2:163973764-163973786 ATTGCCTCAAGAGTGTGCCATGG - Intergenic
945410571 2:209501444-209501466 ATTGGGGCAGGAGTGTGGCAAGG + Intronic
945744031 2:213698752-213698774 AGTCGGACATGAGTGTGCCATGG - Intronic
953011432 3:39028934-39028956 ATTGCAACATGAGTTTTATAGGG + Intergenic
953810462 3:46108265-46108287 ACTGAGACATGGGTGTGGCATGG - Intergenic
955134477 3:56202617-56202639 ATTGTGAAATGATTGTCACAAGG + Intronic
955504885 3:59622032-59622054 ATTTCAACATGAGTTTTACAGGG - Intergenic
963792009 3:149593018-149593040 ATTGGTACATGAGTGTAACTTGG - Intronic
965151054 3:164975273-164975295 ATTGCAACATGAGTTTGGAATGG - Intergenic
967277932 3:187794981-187795003 ATTGCGAGTGGAATGTGACAAGG + Intergenic
967698419 3:192562975-192562997 TTTGCCACATGAGTATGACCAGG + Intronic
970801206 4:19975689-19975711 AGTGGGACATGATTGAGACATGG - Intergenic
973804864 4:54515830-54515852 ATTGCGACATGAGTTTTGGAAGG + Intergenic
974283409 4:59830366-59830388 ATTTCAACATGAGTTTGAGAAGG + Intergenic
977483167 4:97605578-97605600 ATTGAGAAATGACTGTGACTTGG + Intronic
978728078 4:111994060-111994082 AGTGGGAGATGAGTGGGACATGG - Intergenic
979664196 4:123293038-123293060 ATTGCGACATGAGTGTGACAGGG - Intronic
979995017 4:127421355-127421377 TTTGCAACATGAGTGGGAGAAGG - Intergenic
980382406 4:132040685-132040707 CTTGCCACATGAGGGTGAAATGG + Intergenic
984500338 4:180550583-180550605 AGTTAGACATGAGTGGGACATGG - Intergenic
990000584 5:50886917-50886939 ATGGAGAGAAGAGTGTGACAAGG + Intergenic
990052594 5:51524885-51524907 ATTGCAACAAGAATGTGAAAAGG + Intergenic
995130490 5:108624817-108624839 ATTTCTTCATGACTGTGACATGG - Intergenic
996110802 5:119564203-119564225 CTTGGGACATGAGGGTGACCTGG - Intronic
997776865 5:136617005-136617027 ATAGAGAGATGAGTGAGACACGG + Intergenic
997867843 5:137480614-137480636 AATGGCCCATGAGTGTGACAGGG + Intronic
1007262683 6:40574942-40574964 ACTTCGCCATGAGTGTGACCTGG + Intronic
1008901578 6:56624577-56624599 ATTGTGTCATGAGAGTGACCAGG + Exonic
1010718674 6:79258900-79258922 ATTGATACATAGGTGTGACATGG + Intergenic
1016080535 6:139849593-139849615 ATGTAGACAAGAGTGTGACAAGG - Intergenic
1016615780 6:146046847-146046869 ATTGCCACATCATTGTGAGAGGG + Intronic
1017462093 6:154660757-154660779 AGTGTGACATGAGTGAGAAACGG + Intergenic
1018837205 6:167494095-167494117 AATGGGACATGAGCGTAACAGGG + Intergenic
1024496256 7:50049922-50049944 ATTGTTACATGACTTTGACAAGG + Intronic
1032515226 7:132501865-132501887 ATTGGGACATGAGTGTGGCATGG + Intronic
1039414178 8:37379397-37379419 ATAGCGATATGAGTGTGACATGG - Intergenic
1051037526 9:12766635-12766657 TTTGCCACATGAGACTGACAAGG + Intergenic
1058971449 9:110087094-110087116 ATTGGGAGTTGGGTGTGACAGGG - Intronic
1059764001 9:117366074-117366096 TTTGCAAGATGAGTGAGACAAGG - Intronic
1059834040 9:118129773-118129795 ACTGGGTCAGGAGTGTGACAAGG + Intergenic
1061462307 9:130750122-130750144 ATTGAGCCATGATTGTGCCACGG + Intronic
1185733116 X:2477122-2477144 ATGCCAACATGAGTGTGAGAAGG + Intronic
1193957050 X:87876503-87876525 GTTGAGACATTAGTGTGCCAGGG + Intergenic
1194071261 X:89328867-89328889 ACTGGGACATGGTTGTGACAAGG - Intergenic
1199069710 X:143462241-143462263 ATTGATACGGGAGTGTGACAGGG + Intergenic
1200725494 Y:6664605-6664627 ACTGGGACATGGTTGTGACAAGG - Intergenic