ID: 979664197

View in Genome Browser
Species Human (GRCh38)
Location 4:123293039-123293061
Sequence CATTGCGACATGAGTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664197_979664199 2 Left 979664197 4:123293039-123293061 CCTGTCACACTCATGTCGCAATG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664197_979664200 13 Left 979664197 4:123293039-123293061 CCTGTCACACTCATGTCGCAATG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 979664200 4:123293075-123293097 GATCAGACGAGGCACTTCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664197 Original CRISPR CATTGCGACATGAGTGTGAC AGG (reversed) Intronic
904189232 1:28730693-28730715 CAATGTGACTTCAGTGTGACTGG + Intergenic
908426668 1:64014258-64014280 CACTGGGACCTGAGTGTGGCTGG - Intronic
911682445 1:100732939-100732961 CATTGCCTCATAAGTGTAACTGG - Intronic
1064714949 10:18167141-18167163 CACAGCGACATGAGTGGAACTGG + Intronic
1065158254 10:22893314-22893336 CACTGGGTCAGGAGTGTGACTGG - Intergenic
1070910330 10:80112300-80112322 AAGTGCGACATGAGAGTGACGGG - Intergenic
1078835488 11:15025439-15025461 CATTGAGAGATGAGTATCACAGG - Intronic
1079627479 11:22633753-22633775 CACTGGGTCAGGAGTGTGACTGG - Intronic
1079974536 11:27075597-27075619 CACTGGGTCAGGAGTGTGACTGG - Intronic
1080706470 11:34699918-34699940 CATTGCAACATGGGTGGAACTGG - Intergenic
1089181637 11:116587287-116587309 GACAGAGACATGAGTGTGACCGG + Intergenic
1089701569 11:120247594-120247616 TATTGAAACATGAGTGTGACCGG - Intronic
1093671249 12:21878678-21878700 CATAGCTTTATGAGTGTGACAGG + Intronic
1095777199 12:46023427-46023449 CATTGGGACAGGAGTGAGTCTGG - Intergenic
1095786248 12:46111212-46111234 CATTGGGTCAAGGGTGTGACTGG + Intergenic
1097799404 12:63896621-63896643 CATTCCCACATGATTGTAACTGG - Intronic
1106648693 13:31665639-31665661 CATTGCTACTGGAGTGTCACTGG - Intergenic
1107277182 13:38689964-38689986 CATGGCCACATGAGAGTGTCTGG + Exonic
1116274337 14:42811163-42811185 CACTGGGACAAGAGTGTGTCTGG - Intergenic
1118455754 14:65944599-65944621 CATTTCAACATGAGTTTTACAGG + Intergenic
1118908787 14:70044100-70044122 CATTGGCACCTGAGTGTGAGAGG + Intergenic
1119836326 14:77753310-77753332 CATTGCACAATGAGGGTGACAGG - Intronic
1130735456 15:86543830-86543852 CTTTGAAACATGAGTGTTACTGG + Intronic
1130862345 15:87902261-87902283 CATTTCTACAAGAGTGGGACGGG - Intronic
1139170449 16:64625163-64625185 CACTGGGTCAGGAGTGTGACAGG - Intergenic
1139340745 16:66266529-66266551 GATTTAGACATGGGTGTGACTGG + Intergenic
1143220340 17:5256155-5256177 CTTTGGGACTTGAGTGTGAATGG - Intergenic
1150992935 17:70282029-70282051 CATTGTGACATGTTTGTGATGGG + Intergenic
1156363651 18:36406212-36406234 CAATGCCATATCAGTGTGACAGG - Intronic
1158531578 18:58267624-58267646 CATTGCAACATGAAAATGACAGG - Intronic
1159565645 18:70045664-70045686 CATTTTGTCATGAGTGTGCCAGG + Intronic
1160560027 18:79750360-79750382 AATTGCTACATGAGAGTGAGGGG - Intronic
1164904748 19:31958179-31958201 CATTGCGGCATTTGTGTGACTGG - Intergenic
1166471530 19:43083099-43083121 CAATGGGACATCACTGTGACAGG - Intronic
926954986 2:18284521-18284543 CATTGTGACATGAGCTTGTCTGG + Intronic
929390074 2:41459421-41459443 GATTGAGACATCAGTGTGCCAGG - Intergenic
932113558 2:69023914-69023936 CTTTGTAATATGAGTGTGACAGG + Intronic
933217693 2:79649314-79649336 CATTGTAACATGATAGTGACAGG - Intronic
936885690 2:117308325-117308347 CACTGAGTCAGGAGTGTGACTGG - Intergenic
943967749 2:194359357-194359379 CATGGCGACATGAGTGACCCAGG + Intergenic
945852693 2:215028693-215028715 AAATGCAACAGGAGTGTGACAGG + Intronic
947245045 2:228037452-228037474 CATTGCAACATGAATGTGCCAGG - Intronic
1179610616 21:42547783-42547805 CAATACTACATGAGTGTGCCAGG - Intronic
956499978 3:69871817-69871839 AATTCAGACATGAGTGTGAAAGG - Intronic
958652245 3:96952289-96952311 CATTGCAACATGAGTTTCAGTGG - Intronic
977510073 4:97952023-97952045 CAATGGGTCATGAGTGTGTCTGG - Intronic
979664197 4:123293039-123293061 CATTGCGACATGAGTGTGACAGG - Intronic
979944626 4:126813435-126813457 AATTGTGACATTAGTGTGTCCGG - Intergenic
980172130 4:129302686-129302708 ATTTGCAACATGAGTGGGACTGG + Intergenic
988510652 5:31861881-31861903 CATTGCTACTTGAGTCAGACCGG - Intronic
995115461 5:108473149-108473171 CACTGGGTCAGGAGTGTGACTGG + Intergenic
1013036370 6:106387976-106387998 TATTGAGCCATGAGTGTGCCAGG + Intergenic
1016329233 6:142939148-142939170 CATTGCCAAATGTGTATGACAGG - Intronic
1020997504 7:15281515-15281537 CATTGGGTCAGGAGTGTGTCTGG + Intronic
1026447988 7:70502140-70502162 CATGGTGACAGCAGTGTGACAGG + Intronic
1047332988 8:123909246-123909268 CATGGGGACATGAGTGTGTGGGG + Intronic
1056757013 9:89388201-89388223 CATGGGGAAATGGGTGTGACAGG - Intronic
1060022866 9:120147228-120147250 CATTGGGAAATTAGTGTGGCTGG - Intergenic
1192727132 X:73765341-73765363 CACTGTGTCAGGAGTGTGACTGG - Intergenic
1193387040 X:80884368-80884390 CATGGGGACAGGAGTGTGTCTGG + Intergenic