ID: 979664199

View in Genome Browser
Species Human (GRCh38)
Location 4:123293064-123293086
Sequence CTGGATATTCAGATCAGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979664196_979664199 3 Left 979664196 4:123293038-123293060 CCCTGTCACACTCATGTCGCAAT 0: 1
1: 0
2: 2
3: 4
4: 85
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664195_979664199 6 Left 979664195 4:123293035-123293057 CCTCCCTGTCACACTCATGTCGC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664197_979664199 2 Left 979664197 4:123293039-123293061 CCTGTCACACTCATGTCGCAATG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664193_979664199 30 Left 979664193 4:123293011-123293033 CCAGACCAGCACGAAAGCAATCT 0: 1
1: 1
2: 4
3: 27
4: 96
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72
979664194_979664199 25 Left 979664194 4:123293016-123293038 CCAGCACGAAAGCAATCTGCCTC 0: 1
1: 1
2: 11
3: 30
4: 385
Right 979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG 0: 1
1: 1
2: 1
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979664199 Original CRISPR CTGGATATTCAGATCAGACG AGG Intronic
902765955 1:18615395-18615417 CTGGAAATTCAGAACAGAATAGG + Intergenic
911819382 1:102397890-102397912 CTGAATATTCAAATGAGATGAGG + Intergenic
912271546 1:108215574-108215596 CAGGAGTTTGAGATCAGACGGGG - Intergenic
924937848 1:248787418-248787440 CTGGATATTCATCTCAGAACTGG - Intergenic
1063953863 10:11247916-11247938 CTGGGTCTTCAGAACAGAGGAGG - Intronic
1068037739 10:51782423-51782445 CTGTATCTTCATATCATACGAGG + Intronic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1073257342 10:102161438-102161460 CAGGAAATTCAGATCAGCCTGGG - Intronic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1074967121 10:118501191-118501213 CTGGATGTGCAGAGCAGATGAGG - Intergenic
1074993656 10:118735891-118735913 CTAGATAATCAGAACAGACAAGG + Intronic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1086065880 11:82744168-82744190 CTGGATATTTGGATCAAACAAGG - Intergenic
1087876285 11:103361919-103361941 CTGGATATTCAGAATAAAAGTGG + Intronic
1088472520 11:110201608-110201630 CTGGATATTCACAACACAGGAGG + Intronic
1095467450 12:42502690-42502712 ATGTATTTTCAGAGCAGACGCGG + Intronic
1097417503 12:59329873-59329895 CTAGATATACAGATCAGTCTAGG + Intergenic
1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1108019644 13:46113897-46113919 CAGGATTTTGAGATCAGACTGGG - Intergenic
1109421287 13:62115682-62115704 CTGGAGAATCAGATCACACCTGG - Intergenic
1114436648 14:22712454-22712476 CTGGATATTAACATCACAGGAGG - Intergenic
1125929619 15:43591004-43591026 CTGTATATTCAGTAGAGACGGGG - Intergenic
1125942786 15:43690836-43690858 CTGTATATTCAGTAGAGACGGGG - Intergenic
1127460161 15:59191279-59191301 GTGGATATTTAGTACAGACGGGG - Intronic
1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG + Intergenic
1130003829 15:80074215-80074237 CTGGATATTAAAATCAGCTGAGG + Intronic
1130169218 15:81494626-81494648 CTGGATATTGAGGTGAGACCTGG - Intergenic
1131357653 15:91759585-91759607 CTTGATATTCAGCACAGACTTGG - Intergenic
1132700251 16:1219190-1219212 CTGGTCCTTCAGATGAGACGAGG - Intronic
1133832585 16:9337787-9337809 GTGGGTATTCAGCTCAGACATGG - Intergenic
1136632387 16:31496574-31496596 CTGGATGTTCTGATCACATGAGG - Intronic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1140573405 16:76135450-76135472 CAGGATATTTAGCTCAGAGGAGG + Intergenic
1164793643 19:31008795-31008817 CTGGAGTTTCAGATCAGGCTGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926027540 2:9557686-9557708 CTGGTTATTCAGGCCAGGCGCGG - Intergenic
929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG + Intergenic
929788213 2:45006861-45006883 CTGGATTTTCAGATCACTCTAGG + Intronic
931453635 2:62389404-62389426 CTGGAGATGCAGATCAGCCCAGG - Intergenic
935368714 2:102322113-102322135 CTGGAAATTCAGATAAGAGTTGG + Intronic
937553907 2:123130970-123130992 CTGGATATTCAGAAAAGTCATGG - Intergenic
939957077 2:148536076-148536098 CTAGATATTGAGAGCAGACCAGG - Intergenic
942169542 2:173276369-173276391 CTGGAAAGTCAGATCAGGCATGG - Intergenic
944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG + Intronic
945340131 2:208642644-208642666 CTGGTTTCTCAGATCAGACCAGG + Intronic
946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG + Intronic
1178179224 21:30140689-30140711 CTGGATATGCATATCAGACAAGG + Intergenic
1178190076 21:30270021-30270043 CTGGATCTTCATATCAGGAGGGG + Intergenic
1184483110 22:44759602-44759624 CTGGGTATGCAGATGAGACCCGG - Intronic
1184843113 22:47064042-47064064 CTGGAGATGCAGTTCAGAGGAGG - Intronic
955276075 3:57548498-57548520 CTGGAGTTTGAGATCAGACTGGG + Intergenic
958059961 3:88467039-88467061 CTGGATATCCCGTTCAGATGTGG - Intergenic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
972333812 4:38087667-38087689 CTGTATTTTCAGTTGAGACGGGG - Intronic
972697658 4:41463924-41463946 CTGGAGTTTGAGATCAGACTGGG - Intronic
974124244 4:57676278-57676300 CTGGACTTCCAGGTCAGACGGGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
984427772 4:179609536-179609558 CTGTATTTTCAGTTGAGACGAGG - Intergenic
991414772 5:66380493-66380515 TTGGCTATTCAGATCAGACAGGG - Intergenic
993308989 5:86304429-86304451 CAGGAGTTTGAGATCAGACGGGG + Intergenic
998613354 5:143713031-143713053 CTAGATAATAAGATCAGAGGTGG - Intergenic
1004851206 6:19701705-19701727 TTGGAAATTCAGGTCAGAAGAGG - Intergenic
1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG + Intergenic
1019726237 7:2604317-2604339 CAGGAAATTCAGATCAGCCCGGG - Intronic
1020675453 7:11178609-11178631 TTGTATTTTCAGTTCAGACGGGG + Intergenic
1030504203 7:110399120-110399142 CTGAATATTAAGATCAGCAGAGG + Intergenic
1030938066 7:115611349-115611371 TTGGATAGTCAAATCAGACAAGG + Intergenic
1039512795 8:38105232-38105254 CTGGATATTCTGCGCAGAAGAGG - Exonic
1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG + Intergenic
1048538667 8:135322261-135322283 CTGAATATTTAGATGAGACAGGG + Intergenic
1052791360 9:32878126-32878148 CAAGTTATTCAGATCAGACCAGG + Intergenic
1056278754 9:85019162-85019184 CTGGATATTGAGATTAGAATTGG + Intronic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1185970203 X:4654225-4654247 CTGGAGTTTCAGATCAGCCTGGG + Intergenic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1193580056 X:83252905-83252927 CTGGCTATTCATATCAGACAGGG - Intergenic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic