ID: 979666054

View in Genome Browser
Species Human (GRCh38)
Location 4:123312049-123312071
Sequence CCAGATGAGCATGTGTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979666054 Original CRISPR CCAGATGAGCATGTGTACCA TGG (reversed) Intronic
901613341 1:10517133-10517155 TCAGAGGAGCACGTGAACCAGGG + Intronic
902487835 1:16760037-16760059 CCAGATAAGCCAGAGTACCAGGG - Intronic
904490075 1:30853222-30853244 CCAGAGGATCATGTGTGCCCAGG + Intergenic
904571942 1:31472865-31472887 TCAGATGAGACTTTGTACCATGG - Intergenic
906237572 1:44221239-44221261 CCACAGAAGCCTGTGTACCAGGG + Exonic
908011783 1:59785902-59785924 CCAGATGAGACTTTGGACCATGG - Intergenic
910095796 1:83520103-83520125 ACACAAGGGCATGTGTACCAGGG + Intergenic
910240753 1:85083284-85083306 CCAGATGAGCCTGGGTAACATGG + Intronic
913459630 1:119070465-119070487 CCAGATCAGCCTGGGTAACAAGG - Intronic
914146726 1:145001818-145001840 CCAGATGAGCCTGGGCAACATGG + Intronic
916626654 1:166565352-166565374 CCAGATGATGATATGTACTATGG - Intergenic
917415278 1:174802797-174802819 AAAGTTTAGCATGTGTACCAGGG + Intronic
920008201 1:202848820-202848842 CCAGCTGAGCATGGGGACCTGGG + Intergenic
921989081 1:221344810-221344832 CCCAATGAGCATGTGTGCAAGGG + Intergenic
923338101 1:232986962-232986984 TCGGATGAGCATGGGAACCAAGG - Intronic
923571985 1:235124395-235124417 CCAGATGAGAAAATGTACCAAGG + Intronic
923713333 1:236404358-236404380 CCAGATGTGAGTGTGTACCAGGG - Intronic
1065021241 10:21503120-21503142 AAAGATGAGCCTTTGTACCAAGG - Intergenic
1068579868 10:58727384-58727406 CGAGACCAGCCTGTGTACCATGG + Intronic
1070538599 10:77399559-77399581 CCAGTTGAGCCTGAGTGCCAGGG + Intronic
1070972370 10:80578169-80578191 CCAGATGAGCCTGGGCAACATGG - Intronic
1072543603 10:96417131-96417153 CCAGATCAGCATATGTTCCATGG + Intronic
1072662320 10:97370542-97370564 CCAGGTGATCCTGTGCACCAAGG - Exonic
1076473345 10:130735518-130735540 CAAGGTCAGCAGGTGTACCATGG + Intergenic
1076473349 10:130735541-130735563 CAAGGAGAGCAGGTGTACCATGG + Intergenic
1077030826 11:466171-466193 CCAGACCAGCCTGTGTAACATGG + Intronic
1080415321 11:32064840-32064862 CCAGCTGAGGATCTGTTCCATGG + Intronic
1081656133 11:44858705-44858727 CCAGATGAGCTTGTGTGTGATGG + Intronic
1081804119 11:45880840-45880862 CCAGAGGAGCTTGTGTCCCTGGG + Intronic
1083263313 11:61534804-61534826 CCACATGTCCATGTGTGCCATGG - Intronic
1085525313 11:77160432-77160454 CCAGAGGAGCATGGGCACCTGGG - Intronic
1087893655 11:103563761-103563783 CCAAATGAGCCTGGGTAACATGG + Intergenic
1087976328 11:104552208-104552230 TCTGATGAGCAGGTGTGCCAGGG - Intergenic
1088907916 11:114168899-114168921 CCAGAGGAGCATGTGTTCAGTGG + Intronic
1095083050 12:38029786-38029808 CCAGGTGAGCATGGGTACAGAGG + Intergenic
1096673569 12:53214445-53214467 CCAGCTGGGCAAGTATACCACGG - Exonic
1097615343 12:61878889-61878911 CCTCATGATCATGTGAACCAAGG - Intronic
1098189721 12:67935395-67935417 CCAGCTTAGCAAGTGTCCCAAGG + Intergenic
1100546301 12:95605850-95605872 CCAGATCAGCCTGGGTAACATGG - Intergenic
1101287493 12:103330250-103330272 CCAGATGAACCTGTGTACAAAGG + Intronic
1102070068 12:110011313-110011335 CCAGGTGTGCATGTCTAGCATGG + Intronic
1103531878 12:121608117-121608139 CCAGATCAGCCTGGGTAACATGG - Intergenic
1107302198 13:38977496-38977518 CCAGATGAATATGTATTCCAGGG + Intronic
1109403903 13:61873057-61873079 CAAGATGAGCCTGGGTAACATGG - Intergenic
1111003810 13:82222136-82222158 CAGCATGAGCATGTGTGCCAAGG + Intergenic
1111225257 13:85262705-85262727 TCACATGCGAATGTGTACCAAGG + Intergenic
1113389878 13:109885339-109885361 GCAGATGAGCCTGGGAACCAAGG + Intergenic
1117882265 14:60323657-60323679 ACGGAAGAGCATGTGAACCACGG + Intergenic
1118045522 14:61967123-61967145 CCAGAGGAGCAGTTGTCCCAGGG + Intergenic
1120639356 14:86991529-86991551 CCAGAACAGCATGGGTAACATGG - Intergenic
1122189143 14:100026048-100026070 CCAGATCAGCCTGGGTAACATGG + Intronic
1202845097 14_GL000009v2_random:163671-163693 CCAGATGTGCATATGGAACATGG + Intergenic
1125648582 15:41294190-41294212 CCAGAATAGCATGTGACCCATGG - Intergenic
1128251540 15:66167300-66167322 GCAGAAGGGCATGTGGACCAAGG - Intronic
1129957702 15:79654592-79654614 CCAGATGAGCATGTTGACCAAGG - Intergenic
1130889562 15:88121893-88121915 GAAGATGAGCTTGTGTCCCAAGG + Intronic
1136140484 16:28285137-28285159 CCAGATCAGCATGGGCAACATGG - Intergenic
1136158093 16:28398909-28398931 CAAGATCAGCATGGGTAACATGG + Intronic
1136204994 16:28716374-28716396 CAAGATCAGCATGGGTAACATGG - Intronic
1139670248 16:68487955-68487977 CTAGAGGCACATGTGTACCAAGG - Intergenic
1140356912 16:74314362-74314384 GCAGATGTGCATGTGTAATATGG - Intergenic
1146757475 17:35446063-35446085 GCTGAGGGGCATGTGTACCATGG + Intronic
1149484212 17:57029337-57029359 CCAGATGTGTGTGTGTAGCAGGG - Intergenic
1149950086 17:60976532-60976554 GCAGATGAACATGTGAACAAAGG + Intronic
1156325459 18:36070665-36070687 CCAGATTAGACTGTGGACCAAGG - Intergenic
1157200361 18:45654194-45654216 CCAGTTGAGGAAGGGTACCATGG - Intronic
1157523487 18:48361560-48361582 CCAGAGCAGCATATGTACCTAGG - Intronic
1159038226 18:63297909-63297931 ACAGATGAGCACGTGTCCCTGGG + Intronic
1159043312 18:63345409-63345431 CAAGATAAGCATGTGCAGCAGGG - Intronic
1160156838 18:76441226-76441248 CCAGGTGAGCAAGTGTACCCAGG - Exonic
1160373285 18:78391559-78391581 CAAGACGAACATGTGTATCATGG - Intergenic
1161716331 19:5877989-5878011 CCAGCTGGGCCTGGGTACCAGGG - Intronic
1161723057 19:5914306-5914328 CCAGGTGAGCATCTGAACAAGGG + Exonic
1161791638 19:6363462-6363484 CCAGATGTGCCAGTGGACCATGG - Intronic
1163035209 19:14565772-14565794 CCAGATGACCATCTGGGCCAAGG + Exonic
1166303577 19:41925513-41925535 ACAGGTGAGCAAGTGTACAAGGG + Intronic
1166594857 19:44036574-44036596 CCAAATTAGCATGTGAGCCAAGG + Intergenic
926131308 2:10304424-10304446 CCAGAGGAGGATGTTTGCCAGGG + Intronic
930732961 2:54745574-54745596 CGAGATGAGCCTGGGTAACATGG + Intronic
939329513 2:140739019-140739041 CCAGTGGAGCATGTGCAGCATGG + Intronic
939869942 2:147515812-147515834 CCAGATCAGCATGGGCAACATGG - Intergenic
944973198 2:205017637-205017659 CTAGATGAGCATGAGAACCCTGG - Intronic
948519545 2:238526890-238526912 CCAGGTGAGCGTGTGTAGGAAGG - Intergenic
1169353228 20:4887032-4887054 CCAGGAGAGCATCTGTAACAAGG - Intronic
1171048819 20:21836836-21836858 CCAGGGGAGTATGTGTACTAAGG - Intergenic
1172938707 20:38639786-38639808 GCAGATCAGCATGTGTTGCACGG + Intronic
1175844776 20:62052618-62052640 ACAGATGGGCAAGTGTCCCATGG + Intronic
1175868933 20:62198144-62198166 CCAGACGGGCATTTGTACCAGGG + Intronic
1175970208 20:62682497-62682519 ACAGATGAGCATGGAGACCACGG + Intronic
1177586830 21:23107725-23107747 CCAGATGAGCTTGAGTAACATGG + Intergenic
1180127368 21:45801482-45801504 CAAGAAGAGCAAATGTACCAAGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184521493 22:44997104-44997126 CCAGATGAGGATGTTCAGCAGGG - Intronic
1185201172 22:49506344-49506366 CCAGCTCAGCAGGTTTACCATGG - Intronic
1185263764 22:49886538-49886560 CCTGTTGAGGATGTGTACCATGG - Exonic
955244629 3:57212984-57213006 CCCCATGTGCATGTGTGCCAGGG - Intronic
955741232 3:62093616-62093638 GGAGATGAGCATGTGGAACAAGG + Intronic
957100725 3:75824597-75824619 CCAGATGTGCATATGCAACATGG + Intergenic
958613201 3:96454064-96454086 CCAGACGAGCCTGTGCAACATGG + Intergenic
958644795 3:96856036-96856058 CAAGATTAGCCTGTGTAACATGG + Intronic
958833323 3:99115450-99115472 GCAGATGAGCCTCTCTACCAAGG + Intergenic
960673083 3:120170577-120170599 CCACATGAGAATGTGCACGATGG - Intronic
967603824 3:191420556-191420578 TCAGATGGGCATGTGTAACAGGG + Intergenic
968502632 4:958148-958170 CCAGCTGGCCATGTGGACCACGG + Exonic
970057209 4:11988561-11988583 TCAGATTGGCATGTGTCCCAGGG - Intergenic
970066390 4:12099141-12099163 GCTAATGAGCATCTGTACCATGG + Intergenic
971255144 4:25007778-25007800 CCAGCTGTCCATGTGCACCAGGG - Intronic
972035601 4:34515344-34515366 CAGGATGAGCAAGTTTACCAGGG - Intergenic
972160279 4:36217023-36217045 CTATATGAGCATGTGAAACAGGG + Intronic
974907347 4:68074894-68074916 CCAGATGAGCCTGGGCAACATGG + Intronic
976602337 4:86949743-86949765 CCAGATGACCATCTGGGCCAAGG - Intronic
977096534 4:92751943-92751965 CCAGATGAGCCAGTGTTCTAAGG + Intronic
979666054 4:123312049-123312071 CCAGATGAGCATGTGTACCATGG - Intronic
980682427 4:136180813-136180835 CCAGATCAGCCTGTCCACCATGG + Intergenic
982950134 4:161684104-161684126 CCATGTGTACATGTGTACCATGG - Intronic
989095635 5:37778803-37778825 CCAAATGTGCAAGTGTGCCATGG - Intergenic
995372073 5:111429570-111429592 CCAGATCAGCATGGGCAACATGG + Intronic
997419305 5:133753324-133753346 CCAGATGGGCATGTGTCCACTGG + Intergenic
998110720 5:139500485-139500507 CCAGATTAGCCTGGGTAACATGG - Intergenic
998154635 5:139777681-139777703 CGAGATGAGCCTGTGCAACATGG + Intergenic
1001861096 5:175056479-175056501 CCACATGAAGATGTGTAGCATGG - Intergenic
1002057268 5:176605600-176605622 CCAGATCAGCATGGGCAACACGG + Intronic
1002892697 6:1349687-1349709 CAAGAAGAACATTTGTACCATGG - Intergenic
1003296915 6:4837976-4837998 CGAGATGAGCCTGGGTAACATGG - Intronic
1003421640 6:5963571-5963593 CTAGATGAGCCTGAGTCCCAGGG - Intergenic
1004871518 6:19909193-19909215 CCAGATGAACATATGTACCCGGG + Intergenic
1007961839 6:45967230-45967252 CCAGATGGGCATCTTTACCAAGG + Intronic
1013204226 6:107932146-107932168 CCTGATGAGTATGTTTACCTTGG - Intronic
1014334424 6:120115142-120115164 CCAGACCAGCCTGTGCACCATGG - Intergenic
1016904480 6:149135459-149135481 CCAGATGTGCAAGGGTATCAGGG - Intergenic
1019053471 6:169202312-169202334 CAAGGTAAGCATGTGGACCACGG - Intergenic
1021743023 7:23706808-23706830 CCAAGTGACCAGGTGTACCAGGG - Intergenic
1037752918 8:21694330-21694352 CCAGCTGAGCTTCTGGACCAGGG - Intronic
1039524313 8:38200205-38200227 CCAGATCAGCCTGTGCAACATGG - Intronic
1049221838 8:141432043-141432065 CCAGATGCTCATGTGTTCCTGGG + Exonic
1058686320 9:107483812-107483834 CCAGAGGTGCGTTTGTACCATGG - Intergenic
1060456452 9:123803078-123803100 GCAGATGAGAATGTGTATAAAGG - Intronic
1062667810 9:137686588-137686610 CCAGATCAGCATGGGCAACATGG - Intronic
1203756692 Un_GL000218v1:136231-136253 CCAGATGTGCATATGGAACATGG + Intergenic
1189253322 X:39618438-39618460 CCAGATGAGGATGGATAACATGG + Intergenic
1189852205 X:45189091-45189113 CAAGATGAGCCTGGGGACCATGG - Intronic