ID: 979666171

View in Genome Browser
Species Human (GRCh38)
Location 4:123313194-123313216
Sequence GAATGGATGCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 927
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 825}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979666171_979666185 20 Left 979666171 4:123313194-123313216 CCCTCCTCCCTCTGCATCCATTC 0: 1
1: 0
2: 6
3: 95
4: 825
Right 979666185 4:123313237-123313259 TTCAATTCTTCCAGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979666171 Original CRISPR GAATGGATGCAGAGGGAGGA GGG (reversed) Intronic
900190948 1:1351986-1352008 GCATGGATGGGGAGGGAGGGAGG - Intergenic
900391602 1:2436251-2436273 GAAAGGAGGAGGAGGGAGGAGGG - Intronic
900391684 1:2436485-2436507 GAAAGGAGGAGGAGGGAGGAGGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900565677 1:3330853-3330875 GGCTGGAGGCAGAGGGAGGAGGG - Intronic
900650093 1:3726298-3726320 GGATGGATGGAGTGGGTGGATGG + Intronic
900728792 1:4237636-4237658 GAAATGATAAAGAGGGAGGAAGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
900862998 1:5246207-5246229 GAAGGGAGGAAGAGGAAGGAAGG - Intergenic
900932880 1:5747797-5747819 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
901126693 1:6934439-6934461 GAATGGGTGCCCTGGGAGGATGG + Intronic
901316787 1:8315116-8315138 GAAGGATGGCAGAGGGAGGAGGG - Intergenic
901338558 1:8473316-8473338 GAATGGAAGCAAAGAGAGTATGG - Intronic
901634115 1:10662804-10662826 GTATGTCTGCAGAGGCAGGAAGG - Intronic
901664818 1:10820149-10820171 GGAAGGATGCGGTGGGAGGAGGG - Intergenic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902703895 1:18191404-18191426 GAATGGCTTTAGAGGGATGAGGG + Intronic
902709744 1:18230617-18230639 GGATGGGGGCAGAGGAAGGAAGG + Intronic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903009827 1:20321743-20321765 GAATGGATGGAGAGGGCACAGGG + Intronic
903066710 1:20703701-20703723 GAATAGATGGAGAGGAAGGTGGG + Intronic
903139251 1:21329006-21329028 GAATGGATGCAAAGGGAGGTGGG - Intronic
903681378 1:25099579-25099601 GGCTGCATGCAGAGAGAGGAGGG - Intergenic
903846395 1:26282063-26282085 GGAGGGATGCAGTGGGGGGAAGG - Intronic
903965851 1:27088934-27088956 GGAGGGAGGCAGAGGGAGAAGGG + Intergenic
904377591 1:30091501-30091523 GAAGGGATGCAGAGGATGGAGGG + Intergenic
904405673 1:30286520-30286542 GCATGCATGCAGGGAGAGGAGGG + Intergenic
904621402 1:31777460-31777482 GGGTGGATGCAGAGGTAAGAAGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905042674 1:34973193-34973215 GAGTCAACGCAGAGGGAGGAGGG + Intergenic
905918084 1:41699661-41699683 GAAAGGATGCAGAGGGATGCTGG + Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906782812 1:48587397-48587419 GAATGGAGAGAGAGGGAGCAGGG + Intronic
906944590 1:50284927-50284949 GAAGGGATGCTTTGGGAGGAGGG + Intergenic
907106682 1:51889305-51889327 GAATCCAAGCAGAGTGAGGAGGG + Intergenic
907238182 1:53065516-53065538 GAATGGAGGAAGAGGTAAGAAGG - Intronic
907823123 1:57990075-57990097 GAAAGACTGCAGAGGGAGGAAGG + Intronic
907994892 1:59620074-59620096 TTATGGAGTCAGAGGGAGGAAGG + Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910324804 1:85994479-85994501 GAATGTATGCAGAGGGAGAGAGG + Intronic
910333006 1:86097539-86097561 GAAGGGAGGAGGAGGGAGGAGGG - Intronic
910355391 1:86346871-86346893 AAATGGATACAGAGGTAGTATGG + Exonic
910453228 1:87368329-87368351 GAATGAATGGAGAGGCAGCATGG - Intergenic
910597233 1:88992922-88992944 GAATGGATGGAAATGGAGGAGGG + Exonic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911892423 1:103388814-103388836 GAAAGGGTGCAGTGGTAGGATGG - Intergenic
912001316 1:104838117-104838139 GTATAGATACAGTGGGAGGAGGG - Intergenic
912214028 1:107586684-107586706 GAAGGAATGAAGAGGTAGGAAGG + Intronic
912756159 1:112326263-112326285 GAATGGAGGCAGCTGGAGCAAGG - Intergenic
913647899 1:120878266-120878288 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914078729 1:144384580-144384602 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914100450 1:144581922-144581944 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914173636 1:145253124-145253146 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914197847 1:145459155-145459177 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914298543 1:146355753-146355775 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914476950 1:148032279-148032301 GAAGGGAGGGAGAGAGAGGAAGG + Intergenic
914528298 1:148494305-148494327 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
914638095 1:149572800-149572822 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
914689792 1:150015685-150015707 GCATGGAGGAAGAAGGAGGATGG - Intergenic
914724441 1:150315922-150315944 AGAAGGATCCAGAGGGAGGAAGG - Intergenic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
915212143 1:154318387-154318409 TAAGGGTTGCAGAGGGACGAAGG - Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915839263 1:159201951-159201973 GCCTGGCTGCTGAGGGAGGAAGG - Exonic
915953436 1:160205269-160205291 GGAGGGATGGAGAGGCAGGAGGG - Intergenic
916352213 1:163863715-163863737 GAATGGATGCATGTGGAGCAAGG + Intergenic
917192216 1:172430016-172430038 GAAGGGGTGTAGAGGGAGAAGGG + Intronic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
917905132 1:179580789-179580811 GAAGGGGTGGAGAGGGAAGAGGG + Intergenic
918595481 1:186287968-186287990 GAAAGGAGAGAGAGGGAGGAAGG - Intergenic
919133142 1:193475943-193475965 GCATGGAAGAAGAGGCAGGAAGG - Intergenic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
919944374 1:202308888-202308910 CATTGAATGCCGAGGGAGGAGGG - Intronic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920672704 1:208016700-208016722 GTAAGGATGCTGAGGGAGAATGG - Intergenic
920706917 1:208258116-208258138 GAAAGGAGGCAGTGGGTGGATGG - Intergenic
920770348 1:208878879-208878901 GAATGACTACAGAGGGAGCATGG - Intergenic
920940159 1:210474599-210474621 GAATGCATGCCGCTGGAGGATGG - Intronic
921285544 1:213606023-213606045 GAATGTCTGCTCAGGGAGGACGG + Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923290530 1:232540629-232540651 GAATGGAAGGAAAGGGAGAAGGG + Intronic
923329905 1:232913413-232913435 GAAAGGATGCAGAGCCAGGAGGG + Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923519357 1:234724128-234724150 AAATGGAGGGAGAGGGAGGGAGG + Intergenic
923678444 1:236100140-236100162 GGATTGTTGCAGATGGAGGAGGG - Intergenic
924890608 1:248274408-248274430 GAAGGTATGTAGTGGGAGGAAGG - Intergenic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1064753278 10:18553530-18553552 GAATGGAATGAAAGGGAGGATGG + Intronic
1064754611 10:18562801-18562823 GAATGGAATGAAAGGGAGGATGG + Intronic
1064755023 10:18565766-18565788 GAATGGAATGAAAGGGAGGATGG - Intronic
1065076470 10:22084527-22084549 GAATGTCTGCAGAGGGAGGGAGG + Intergenic
1065240645 10:23700362-23700384 GGATGGAAGCAGAGAGAGGTTGG - Intronic
1065725715 10:28666174-28666196 GAAGGGCTGCAGAGGGCAGAGGG - Intergenic
1066465214 10:35643792-35643814 GGAAGGAAGGAGAGGGAGGAGGG - Intergenic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1067018677 10:42776272-42776294 AAATGGAGGCAGAGGATGGAAGG - Intergenic
1067238624 10:44472159-44472181 CAAAGGATGCAGAGAGAGGCCGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067439565 10:46300989-46301011 GGATGGATGAAGAGAGAGGGGGG - Intronic
1068007232 10:51406053-51406075 GGATCGCTGCAGAGAGAGGAAGG - Intronic
1069160601 10:65086437-65086459 GAAAGGATGAAGGGGGATGAAGG + Intergenic
1070314550 10:75297329-75297351 GAATAGCTGTAGAGGAAGGAAGG - Intergenic
1070537357 10:77389717-77389739 GGAAGGATGCCGTGGGAGGAGGG - Intronic
1070831412 10:79420195-79420217 GGATGGGTGCTGTGGGAGGAGGG - Intronic
1070857618 10:79619860-79619882 GAATGGAGCCCCAGGGAGGAGGG - Intergenic
1070948857 10:80414821-80414843 GACTGGCTGCAGAGGTACGAAGG + Intronic
1071295768 10:84218124-84218146 CAAGGGATGGAGAGGGAGAATGG + Intronic
1071393595 10:85199681-85199703 GAAAGGAGGAAGAGAGAGGAAGG + Intergenic
1071718835 10:88122707-88122729 GCAGGGATGGAGATGGAGGAGGG + Intergenic
1072124223 10:92431292-92431314 GAAGGGAAGGAGAGGAAGGAAGG - Intergenic
1072261552 10:93679735-93679757 GAATGGATTAAGAGGAGGGAAGG + Intronic
1072341014 10:94449868-94449890 GACTGGATTCAAAGGGAGGGTGG - Intronic
1072677486 10:97479090-97479112 GTATAGAGGCAGAGGGAGGGAGG - Intronic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1073662624 10:105493619-105493641 GAGTAGATGGAAAGGGAGGATGG + Intergenic
1073944061 10:108730245-108730267 GAAGGGAGGTAGAGGGAGGGAGG + Intergenic
1074509737 10:114101295-114101317 CAAAGGATGCAGAGCGAGGAGGG - Intergenic
1074514201 10:114149699-114149721 GAATGGAAGGAAAGGGAGGAAGG + Intronic
1074542285 10:114374826-114374848 GGATGGGGGCAGAGGGAGGGAGG + Intronic
1074609173 10:115004541-115004563 GAAGGGAAGGAGAGGGAGAAGGG - Intergenic
1075153258 10:119953810-119953832 GAAAGGAAGGAGAGGAAGGAAGG - Intergenic
1075153623 10:119956338-119956360 GACTGGAGACAGAGGGAAGAAGG + Intergenic
1075532165 10:123238817-123238839 GACTGGGGGCAGAGGGTGGATGG - Intergenic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075813720 10:125247771-125247793 GGAAGGATGCAGCGGGAGGTGGG + Intergenic
1075923519 10:126232921-126232943 TGATGGAGGCAGAGGAAGGAAGG + Intronic
1075962970 10:126585295-126585317 GCAAGCAAGCAGAGGGAGGAAGG + Intronic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1076369862 10:129945221-129945243 GAAAGGAAGCAGAGGGAGGGAGG + Intronic
1076374794 10:129976097-129976119 GAATGGTTGAAGGTGGAGGAGGG - Intergenic
1076422402 10:130340667-130340689 GGATGGAGGCAGAGGCTGGAGGG - Intergenic
1076717458 10:132373681-132373703 GAGTAGATGCTGAGAGAGGAAGG + Intronic
1076776623 10:132701468-132701490 AAATGGAGGCAGAGGGTGTATGG - Intronic
1077233167 11:1467750-1467772 AAACGGAGGCAGAGGCAGGAAGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077532529 11:3103907-3103929 GATGGGCTGCAGAGGCAGGAAGG - Intronic
1078132647 11:8625272-8625294 GAATGGAGGGAGGGAGAGGAGGG + Intronic
1078149491 11:8746574-8746596 GAGTGAATGCAGAGGAGGGAGGG + Intronic
1078481984 11:11685199-11685221 GAAAGGAGGGAGAGGGAGGGAGG + Intergenic
1078510948 11:11983567-11983589 GACAGGCTGCAGAGGGAGAAGGG + Intronic
1078544751 11:12239292-12239314 GAAGGGAGGCAGAGGCAGCAGGG - Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1079751108 11:24198637-24198659 GAGTGGTTGCAGAGGAAGGCTGG - Intergenic
1079934554 11:26600585-26600607 GAATGGAGGGAGAGGAAGGAAGG - Intronic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080309618 11:30874502-30874524 GCAGGGAGGAAGAGGGAGGAGGG + Intronic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081391381 11:42533284-42533306 GAAAGGAAGAAGAGGGAGGGAGG - Intergenic
1081492723 11:43580173-43580195 GGATGGAGGAAGAGGGAGGGAGG + Intronic
1081625823 11:44654529-44654551 GAATGGAGGAAGGGGGAAGATGG - Intergenic
1081701552 11:45155640-45155662 GGAGGGGTGGAGAGGGAGGAAGG + Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081789956 11:45775532-45775554 GAAGGGAGGCAGAGAGGGGAGGG - Intergenic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082637455 11:55613892-55613914 GAAAGGAGGCAGAGGGAGACAGG - Intergenic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1083261049 11:61523348-61523370 GAATGGAAGCTGAGGCAGGAGGG + Intronic
1083642345 11:64152388-64152410 GAAAGGCTGCAGAGGCAGGAAGG + Exonic
1084495551 11:69501135-69501157 GAAAGGAGGGAGGGGGAGGAAGG + Intergenic
1084742762 11:71150087-71150109 GAAGGGAGGGAGAGGAAGGAAGG + Intronic
1084864251 11:72042578-72042600 GCATGGAAGCAGTGGGAGAAAGG + Intronic
1084936950 11:72592019-72592041 GAGTGGATCTAGAGGGGGGAAGG - Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1086458143 11:86979526-86979548 GAAAGGAAGTAAAGGGAGGAGGG + Intergenic
1086461654 11:87011797-87011819 AAAAGGATGCAGAGTGAGGTGGG + Intergenic
1086497814 11:87422195-87422217 GAATGGAAGTAGGGGCAGGATGG + Intergenic
1086672757 11:89567589-89567611 GAATGAGTGCAGAGGGAAGGGGG + Intergenic
1086803869 11:91214712-91214734 GAATGGATGGGTAGGAAGGAGGG + Intergenic
1087416371 11:97861277-97861299 GAATGGATGGAGAGGGAATATGG - Intergenic
1087471302 11:98578591-98578613 GAAAGGCTGAGGAGGGAGGATGG - Intergenic
1088532459 11:110825905-110825927 GAATGAAGGCAGTGGGAGAATGG + Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089175153 11:116543334-116543356 GGATGGATTCAGAAAGAGGAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089360119 11:117880026-117880048 GAAAGGTTGGAGAGAGAGGAAGG - Intergenic
1089432385 11:118435475-118435497 GTATGCACGCAGAGGGAGGGGGG - Intergenic
1089489214 11:118871401-118871423 GAATGAATGAAGAGGGAGTGAGG - Intergenic
1089766756 11:120773513-120773535 GAATGGATGCAGTGGCAGCCTGG + Intronic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091600404 12:1914530-1914552 GAGTGGATGCAGTGGGATGCAGG - Intronic
1091691723 12:2601761-2601783 CAAGGGATGCTGTGGGAGGAAGG + Intronic
1091858330 12:3756744-3756766 GAAAGGATGAAGAGTGAGGAGGG + Intronic
1092119490 12:6034115-6034137 GAATGGGAGGAGTGGGAGGATGG - Intronic
1092132665 12:6123547-6123569 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1092273810 12:7044118-7044140 GGAGGGAGGCAAAGGGAGGAGGG - Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1092589881 12:9943165-9943187 GAAGGGATGGAGAGTAAGGATGG - Intergenic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092909050 12:13129187-13129209 AAATGGAGGGAGAGGAAGGAAGG - Intronic
1093726595 12:22519043-22519065 GAGTGGCTGCAGAGGCAGGCAGG - Intronic
1093960755 12:25270298-25270320 GAATGGAGGTAAAGGGAAGAGGG + Intergenic
1095226453 12:39683548-39683570 GAATTGATGCAAAGTGAGGTAGG + Intronic
1095702023 12:45200550-45200572 GAATGGAAGTTGGGGGAGGAGGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096262188 12:50099850-50099872 TAAGGGATGCAGAGGCAGGGTGG - Exonic
1096331903 12:50720675-50720697 GAAAGGATGAGGAAGGAGGATGG + Intronic
1096361298 12:50989845-50989867 GAATGGCTACAGATGGAGGCTGG - Intronic
1096518685 12:52172154-52172176 GAAGGGCTGCAGGGGAAGGAGGG - Intronic
1096525782 12:52209457-52209479 GCACGGATGCAGGGGGAGAAGGG + Intergenic
1096741510 12:53697034-53697056 AAATGGATGGGGAGAGAGGATGG - Intergenic
1096754208 12:53785319-53785341 GAATAGATGGAGAGGGACCAAGG - Intergenic
1096817256 12:54209429-54209451 GAATGGAAGAAGAGAGATGAAGG + Intergenic
1096869302 12:54583440-54583462 GACTAGATGCAGAGGGATGGAGG - Intronic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097700575 12:62816154-62816176 TAATGGATACAGAGGCAGCATGG + Intronic
1098008993 12:66030598-66030620 GAAGAGATGGAGAGGAAGGAAGG - Intergenic
1098265807 12:68718115-68718137 GAATGAAGGCACAGAGAGGAGGG - Intronic
1098281719 12:68868692-68868714 GACAGGATACAGTGGGAGGAGGG - Intronic
1098602608 12:72350133-72350155 GAATATATGCAGAGACAGGATGG - Intronic
1098605327 12:72382418-72382440 GAATGGAGGGAGAGGGAGACAGG + Intronic
1099676286 12:85764801-85764823 GAAGGGAGGGAGGGGGAGGAAGG + Intergenic
1099831583 12:87850229-87850251 AAATACATGCAGAGGGATGAGGG + Intergenic
1100002827 12:89858038-89858060 GAATAAATACAGGGGGAGGATGG + Intergenic
1100386059 12:94105360-94105382 GGATGGAGGCATGGGGAGGATGG + Intergenic
1101408899 12:104453241-104453263 GACAAGATGAAGAGGGAGGAAGG - Intergenic
1101681228 12:106967775-106967797 GGATGGATACAGAGGAAGGATGG + Intronic
1101789688 12:107915226-107915248 GAATGGAGAGAGAGAGAGGATGG + Intergenic
1101836560 12:108299701-108299723 GGATGGAGGCAGAGATAGGAGGG + Intronic
1102272904 12:111554680-111554702 CAATGGTTGGAGAGAGAGGAGGG + Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1104162758 12:126195959-126195981 GAATGCATGCAGAGAGTGTAAGG + Intergenic
1104376979 12:128272185-128272207 GACTGGAGGTAGAGGAAGGAGGG - Intronic
1105446554 13:20462125-20462147 GGAGGGATGGAGTGGGAGGAGGG + Intronic
1105664562 13:22538345-22538367 GAATGGATGGATAGGTAGGTAGG - Intergenic
1106310428 13:28549352-28549374 GTCTGGATGGAGTGGGAGGATGG + Intergenic
1106633126 13:31498056-31498078 GACAGGAGGCAGAGGGAGCAAGG + Intergenic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1106865610 13:33960702-33960724 GAATTGAGGCAGTGGGAGAAGGG - Intronic
1107946303 13:45420012-45420034 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
1109181536 13:59219971-59219993 GAAGGGAGGAAGGGGGAGGAAGG + Intergenic
1110060606 13:71033904-71033926 GAAAGGGTTCACAGGGAGGAGGG - Intergenic
1113153925 13:107295633-107295655 AAATGGAAGGAGTGGGAGGAGGG + Intronic
1113304633 13:109064324-109064346 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113618501 13:111697393-111697415 GAAGGGAGGCAGGGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624030 13:111782654-111782676 GAAGGGAGGCAGGGAGAGGAAGG - Intergenic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1115475529 14:33809736-33809758 GGAAGGGTGGAGAGGGAGGAGGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1117665309 14:58050403-58050425 GAATGGGTAGAGAGAGAGGAAGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118354498 14:65001642-65001664 GCATGGATACTGAGGGATGATGG + Intronic
1118470953 14:66074944-66074966 GAAGGGATGGGGAGGGAGGAAGG - Intergenic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1118708825 14:68503184-68503206 GAATGGATTTGGAGGGAGGGTGG + Intronic
1118860079 14:69656137-69656159 GAATGGAGGAAGACGGAGGGAGG - Intronic
1118860086 14:69656163-69656185 GAATGGAGGAATAGGGAGGGAGG - Intronic
1118893121 14:69925215-69925237 GGAGGGATGCTAAGGGAGGAGGG + Intronic
1118936275 14:70291682-70291704 GAAGTGAGGTAGAGGGAGGAGGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119143949 14:72293514-72293536 AAATGGATGGGGAGGAAGGAAGG - Intronic
1119198299 14:72733565-72733587 GGATGGATGGAGAGGGTGGTTGG - Intronic
1119275023 14:73347511-73347533 GAATGGATGCAAAATAAGGAAGG - Intronic
1119980766 14:79078444-79078466 GAATGTATGCAGAGCAAGGTTGG - Intronic
1120367751 14:83592047-83592069 GAATAGAAGGAGAGGAAGGAAGG - Intergenic
1120598113 14:86465581-86465603 GGAGGGAGGGAGAGGGAGGAAGG + Intergenic
1120903161 14:89593215-89593237 GAAGGGAGGAAGAGGGAGAAAGG + Intronic
1120976597 14:90254275-90254297 GAATGGAGGCTGAGGTAGGAAGG - Intergenic
1121335600 14:93076013-93076035 GGATGGATGGAGGGGGAAGAAGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121517962 14:94566074-94566096 GAATCGCTGCAGTGTGAGGAGGG - Intronic
1122011311 14:98751299-98751321 GGATGGATGGAGTGGGTGGATGG + Intergenic
1122120566 14:99551298-99551320 GATTGGAGGCAGTGGGGGGAAGG + Intronic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1123932527 15:25178704-25178726 GGATGCATGCATGGGGAGGAGGG + Intergenic
1124122060 15:26895952-26895974 GCATGGAGGCAGGGGGAGGCTGG - Intronic
1124207313 15:27732550-27732572 GAATGGCAGCAGAGTGTGGAGGG + Intergenic
1125526136 15:40376228-40376250 GAAAGGCTGAAGTGGGAGGATGG + Intergenic
1126109062 15:45165266-45165288 GTAAGGATGCAGTGGGAGCATGG + Exonic
1126389306 15:48128942-48128964 TAATAAATGCAGAGGTAGGAAGG - Intronic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1127259643 15:57318860-57318882 GAAGGAAGGAAGAGGGAGGAAGG + Intergenic
1127302256 15:57666485-57666507 GATTTGGGGCAGAGGGAGGAGGG - Intronic
1127399624 15:58573078-58573100 GAAGGGATTGAGAGGGAGGAGGG - Intergenic
1127768689 15:62212665-62212687 TAATGGTTGCAGAAGGATGAAGG + Intergenic
1127978395 15:64016002-64016024 GAAAGGGGGCATAGGGAGGAAGG + Intronic
1128624166 15:69182521-69182543 GCATGTATGCAAAGGAAGGAAGG + Intronic
1128677979 15:69625799-69625821 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1128677988 15:69625829-69625851 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1128800141 15:70492130-70492152 TAATGGCTGCAGAGGCAAGACGG + Intergenic
1129232109 15:74202715-74202737 GAAGGGAGGCCCAGGGAGGAAGG + Exonic
1129542969 15:76366164-76366186 GCATGGAGGCACAGGGAGGTGGG + Intronic
1130029425 15:80298237-80298259 GAATGAATGGAAAGGGAGAAAGG + Intergenic
1130408228 15:83622346-83622368 GAATGAAAGCTGATGGAGGATGG - Intergenic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130866777 15:87940149-87940171 GAATAGATGTTGAGGGAGGGGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131520253 15:93109146-93109168 AAATGGATGCAGAGCGATGGCGG + Intergenic
1131669018 15:94599726-94599748 GAATGGGGGCAGAGCTAGGAGGG + Intergenic
1131727176 15:95239399-95239421 GAATGGAAGGAGAAGCAGGAGGG + Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133819628 16:9225147-9225169 GAATGGATGGCAATGGAGGAAGG + Intergenic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134052481 16:11146494-11146516 GAATGGATGTAGAGGGAGGGAGG + Intronic
1134374058 16:13653405-13653427 GAATCTAGGCAGATGGAGGAAGG + Intergenic
1135163698 16:20120159-20120181 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135255244 16:20936555-20936577 GACTAGAGGCAGGGGGAGGAGGG - Intronic
1137713506 16:50583496-50583518 GTGTGGTTGCAGGGGGAGGAAGG - Intronic
1137963773 16:52911231-52911253 TAAAGGAAGCAGAGGGAGGGAGG - Intergenic
1138076690 16:54049725-54049747 GAATGTAGGCAAAGGGAAGAGGG + Intronic
1138493063 16:57387926-57387948 GAAGGGAGGGAGAGGAAGGAAGG + Intergenic
1139107691 16:63847920-63847942 GAAAGGAGGCAAAGGGAGGAAGG - Intergenic
1139147420 16:64341499-64341521 GGAAGGAAGGAGAGGGAGGAGGG - Intergenic
1139147448 16:64341589-64341611 GGAAGGAAGGAGAGGGAGGAGGG - Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1141443434 16:84043593-84043615 GATTAGATGCAGCGGGGGGAGGG - Intergenic
1141556207 16:84838397-84838419 GAAAGGAAGCAGAGGGTGGTGGG - Intronic
1141701816 16:85645867-85645889 GAATGCATGCATAGGAAGCATGG - Intronic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1142254319 16:89006684-89006706 GAAGAGATGGAGAGGGAGGGAGG - Intergenic
1142654388 17:1381561-1381583 GAATGCATGTAAAGGGGGGAGGG + Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143625624 17:8108956-8108978 GTGTGGATGCAGGGGAAGGAGGG - Intronic
1144736573 17:17558987-17559009 GCAGGGATGCAGAGAGAGCAGGG - Intronic
1144737898 17:17565092-17565114 GGATGGACGCAGAGGGTGGGAGG - Intronic
1144794402 17:17881327-17881349 GAATGCAAGCAGAGGTAGGCAGG - Intronic
1144877700 17:18411054-18411076 AAAAGGATGGGGAGGGAGGAGGG - Intergenic
1145154529 17:20533349-20533371 AAAAGGATGGGGAGGGAGGAGGG + Intergenic
1146667641 17:34715613-34715635 GAAGGGATGGAGGTGGAGGAGGG - Intergenic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1147165744 17:38592281-38592303 GATCGGAAGCTGAGGGAGGAGGG + Intronic
1147773835 17:42886457-42886479 GGAAGGAAGCAGAGGAAGGAAGG - Intergenic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1148681835 17:49478588-49478610 GGATGGACCCAGTGGGAGGATGG + Intergenic
1148686173 17:49502396-49502418 GGAAGTGTGCAGAGGGAGGAGGG + Intronic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1150164655 17:62930243-62930265 TTATGGCTGCAGAGAGAGGAAGG + Intergenic
1150330211 17:64288184-64288206 GGAAGGAGGAAGAGGGAGGAGGG + Intergenic
1150445764 17:65225949-65225971 CAATGGATGCAGAGGAGGGTGGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1151266436 17:72959569-72959591 GAAGGGTGGCAGAGGGAGGAGGG + Intronic
1151362968 17:73599628-73599650 GAAAGGATGAAGAAGGAGGGAGG + Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1151968770 17:77446295-77446317 GGATGGAGGCAGAGGCTGGAGGG - Intronic
1152110954 17:78357633-78357655 GGGTGGATGGAGCGGGAGGATGG - Exonic
1152541896 17:80981025-80981047 GAATGAGTGAAGAGGGAGGGAGG + Intergenic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1155190154 18:23422500-23422522 GAATTGAGACAGAGGCAGGAGGG - Intronic
1157103157 18:44748179-44748201 GAAAGGATGGAAAGGAAGGATGG + Intronic
1157367692 18:47081014-47081036 GAAGGGAAGGAAAGGGAGGAGGG - Intronic
1157504999 18:48219845-48219867 GGATGGATGGAGAGGGATGGAGG + Intronic
1157526195 18:48384442-48384464 GAATGTATTGAGAGGGAGAAGGG - Intronic
1157627396 18:49061925-49061947 GGATGGAGCCAGATGGAGGATGG - Intronic
1157997398 18:52575208-52575230 GAATGGATACAGAGAGAAGATGG - Intronic
1158009002 18:52706973-52706995 GAAATGATGCAGAGGGATGGAGG + Intronic
1158339933 18:56454863-56454885 GAAAGGAAGGAGGGGGAGGAAGG + Intergenic
1158440578 18:57471130-57471152 GAGGGGATGCAAAGGGAGGCGGG - Intronic
1158503895 18:58028826-58028848 AAATGGATGGAGAGAGAGGAAGG + Intergenic
1158564823 18:58545837-58545859 GAATGGCTGGAGAGAGGGGAAGG - Intronic
1158630757 18:59112102-59112124 GAAGGGATGCACAGGGAGGGGGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159810278 18:73010907-73010929 GAAGGGATTCAGAGGAAGGGTGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160770668 19:829303-829325 GAAGGGACTCAGATGGAGGAGGG + Intronic
1160965250 19:1744574-1744596 GAAAGGAGGGGGAGGGAGGAGGG - Intergenic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1161227395 19:3153359-3153381 GGATGGATGGAGTGGCAGGATGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1161845248 19:6708482-6708504 GAAGGGAGGGAGAGGAAGGAAGG - Intronic
1162153414 19:8661020-8661042 GAAGGGAGGGAGAGGGAGGGAGG - Intergenic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1163176894 19:15570596-15570618 GAATGGATGCACAGGCAGGATGG - Intergenic
1163176918 19:15570814-15570836 GGATGGATGCACAGATAGGAGGG - Intergenic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1164101033 19:22054416-22054438 GAAATGATGAAGGGGGAGGAGGG - Intronic
1164393540 19:27845410-27845432 GAAAGGTTGGAGAGGGAGAAGGG + Intergenic
1164509079 19:28882895-28882917 GAAGGGATGGAGAGGGAAGGAGG - Intergenic
1164676939 19:30107283-30107305 GAATGGAGGCAAATGGAGGCAGG - Intergenic
1164708785 19:30339745-30339767 GAAAGGTTGGAGAGGGAGGTGGG + Intronic
1165101997 19:33444538-33444560 GATTGGATGCAGGGGGTGGAAGG - Intronic
1165333018 19:35151757-35151779 GACTGGACGCAGGGGGCGGAGGG + Intronic
1165653991 19:37517030-37517052 GAATTGGGGCTGAGGGAGGAAGG + Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1167009618 19:46798516-46798538 GAATGAAGGCAGTGGGATGATGG - Intergenic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167554795 19:50187920-50187942 GAATGAAGGGAGAGGAAGGAAGG + Intergenic
1167648688 19:50718720-50718742 GAATGGAGGCGGAGGGAGGCGGG + Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168416449 19:56172130-56172152 GAAGGGAGGAAGAGAGAGGAGGG + Intergenic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168503933 19:56916878-56916900 GAATGGAGGAAAAGGAAGGAAGG - Intergenic
1168517073 19:57017542-57017564 GGAGGGAAGCAGAGGGAGAAGGG - Intergenic
925096342 2:1207480-1207502 GAATGGACACTGAGGGAGGTTGG - Intronic
925102287 2:1257506-1257528 TGATGGATGCAGCGGAAGGAGGG + Intronic
925128898 2:1480792-1480814 GGACGGATGCAGCAGGAGGAAGG - Intronic
925157935 2:1661533-1661555 GCAGGGATGCAGGTGGAGGATGG + Intronic
925166737 2:1720198-1720220 GGAGGGATGCAGAGAGAGGGAGG + Intronic
925166761 2:1720336-1720358 GGAGGGATGCAGAGAGAGGGAGG + Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925588949 2:5491156-5491178 GTCAGGATGCAGAGGGAGCAGGG + Intergenic
926110154 2:10177531-10177553 GAATGGATGCAAAGGAAGCTAGG - Intronic
926263630 2:11292937-11292959 GAAAGGAGGAAGAGGGAGAAGGG - Intronic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
926920730 2:17937390-17937412 GAAGGGATGGAGAGTGGGGAAGG - Intronic
927193718 2:20533915-20533937 GGATGTATGCAGTGGGAGGTTGG - Intergenic
927576449 2:24205572-24205594 TACTGGATGCAGAGGAGGGAAGG - Intronic
927649536 2:24903699-24903721 GAATGGGAGCAGGGGTAGGAGGG + Intronic
928040620 2:27872892-27872914 GAATGGATGCAGAGGGGTAAAGG + Intronic
928314086 2:30232466-30232488 GGAGGGATGCAGAGAGAGGCAGG + Intronic
928438004 2:31268419-31268441 CAATGGAGGCTGAGGGAGAAGGG + Exonic
928469803 2:31562910-31562932 GAATGGAGGTAGATGTAGGAGGG - Intronic
928921795 2:36534522-36534544 GAAGGGAGGGAGAGGAAGGAAGG + Intronic
929164339 2:38865992-38866014 GGAGGGAAGAAGAGGGAGGAAGG + Intronic
929458030 2:42079928-42079950 GGAAGGAAGCAGGGGGAGGAAGG + Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
930198120 2:48529448-48529470 GAGTGCATGGAGAGGGAGAAGGG - Intronic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930360997 2:50379320-50379342 GAATGGTTGCAGAGAAAGGCTGG + Intronic
930452927 2:51566216-51566238 GAAGGTATGGAGAGGAAGGATGG - Intergenic
931071922 2:58661121-58661143 GAAAGGATGATGTGGGAGGATGG - Intergenic
931229891 2:60365353-60365375 GGATGGATGGAGAGGGATGGAGG + Intergenic
932404352 2:71503662-71503684 GGCTGGATGGTGAGGGAGGAGGG - Intronic
932414362 2:71564793-71564815 GAAAGGAGGAAGAGGGAGCAGGG - Intronic
932428894 2:71661675-71661697 GGGAGGATGCAGAGGGAGGGTGG + Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
932863898 2:75321723-75321745 GCAGGGAGGCTGAGGGAGGAGGG - Intergenic
933102180 2:78274583-78274605 GCTTGGATACAGAGGGAGGTGGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935063252 2:99626428-99626450 GAAGGGAAGGAGAGGGAGGGAGG - Intronic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935778859 2:106494522-106494544 AAATGGAAGGAGAGGGAGTAAGG - Intergenic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
936768844 2:115887466-115887488 GGATGGATCAGGAGGGAGGAAGG - Intergenic
936812013 2:116413666-116413688 GGAAGGCTGCAGAGGGAGAAGGG - Intergenic
937609905 2:123848394-123848416 GAATGTGTGTAGATGGAGGAAGG + Intergenic
938169579 2:129063022-129063044 GAATGGATGGGGTGGGTGGAAGG - Intergenic
939167812 2:138658271-138658293 GAATGGATGGGGGGGGAGGAAGG - Intergenic
940189011 2:151018685-151018707 GAACGTAAGCCGAGGGAGGAAGG - Intronic
941264166 2:163338708-163338730 GAAAGGATGCAGCTGGAGAAAGG + Intergenic
942066186 2:172274035-172274057 GAATGGATACAGCTGTAGGAGGG + Intergenic
942639684 2:178048474-178048496 GAATGGATCCAAAGGGTGGACGG - Intronic
943082806 2:183276852-183276874 GAAGGGAGGGAGAGAGAGGAAGG - Intergenic
943344713 2:186724812-186724834 GAATGGATGAAGATGAAGGAGGG + Intronic
944086220 2:195850782-195850804 GAAAGGATGCAGGGGGAAGCAGG + Intronic
944865174 2:203852836-203852858 GAAGGGAGGGAGGGGGAGGAAGG - Intergenic
944913350 2:204332001-204332023 GAAAGGATGGAGATGGAGAAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946135945 2:217646987-217647009 TAAGGAATGCAGAGAGAGGAAGG - Intronic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946388887 2:219403824-219403846 AAATGGAGGCACAAGGAGGAAGG + Intergenic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946634744 2:221712283-221712305 GCATGGTTGTAGTGGGAGGAGGG - Intergenic
946937610 2:224737800-224737822 GAAAGTTTGCAGAGGGAGAAAGG + Intergenic
947587392 2:231364972-231364994 GGAAGGATGCAGTGGGAGGTGGG + Intronic
948260209 2:236598866-236598888 GAATGGATGCAGGGAGATGATGG + Intergenic
948458534 2:238118361-238118383 GAATGGATGGAGGAGGTGGATGG + Intronic
948458825 2:238119468-238119490 GAATGGATGGAGGAGGTGGATGG + Intronic
948458854 2:238119562-238119584 GAATGGATGGAGGAGGTGGATGG + Intronic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
948810965 2:240478110-240478132 GCATGGCTGGAGCGGGAGGAAGG - Intergenic
948904926 2:240975221-240975243 GAATAGATGCAGAGGCAGCAGGG + Intronic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169016872 20:2299354-2299376 GAATGGATGAAGCGGGAGTGGGG - Intronic
1169476315 20:5934159-5934181 GAAAGGCTGGAGAGGTAGGAGGG + Intergenic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1170273139 20:14550460-14550482 GCATGGCTGAAGAGGGAGGGAGG - Intronic
1170464668 20:16611706-16611728 GAATGGATGAAGTGAGAGGAGGG + Intergenic
1170858458 20:20079490-20079512 GAAGGGAAGCAGAGAGAGGGAGG + Intronic
1170900529 20:20457960-20457982 GCCTGGATGCTGAGGGAGGCAGG + Intronic
1171098993 20:22364671-22364693 GATTCAATGCAGTGGGAGGATGG - Intergenic
1171151885 20:22834781-22834803 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171227100 20:23451091-23451113 GAATGAATGGAGATGGATGAGGG - Intronic
1171531472 20:25856255-25856277 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171532890 20:25863754-25863776 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1172015673 20:31871008-31871030 GAATGGATGGGAAAGGAGGAAGG - Intronic
1172195271 20:33087253-33087275 GGAGGGAGGCAGAGGGAGGTGGG - Intronic
1172513597 20:35517133-35517155 GAATAGGTCCAGAGGGAGGCAGG - Exonic
1172782044 20:37442631-37442653 GAATAGATGGAGTGGAAGGATGG - Intergenic
1172891222 20:38266941-38266963 GAATGGAGACAGAGAGTGGAAGG + Intronic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1173532741 20:43782846-43782868 TAAGGGTTGCAGAGGGACGAAGG + Intergenic
1173803263 20:45908192-45908214 GTAGGAATGCAGAGGGCGGAAGG - Intronic
1173819883 20:46013125-46013147 GAAGGGAGGCTGAGTGAGGAGGG + Intronic
1174494303 20:50929535-50929557 GTAAGGCTGCAGAGGGGGGAAGG - Intronic
1175120943 20:56715851-56715873 GAATGGAAGCAGTAGAAGGAAGG + Intergenic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175306192 20:57977226-57977248 GAAAAGCTGCAAAGGGAGGAGGG + Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175657742 20:60786751-60786773 GAATGGATGCAGAGGCATAAAGG + Intergenic
1175816480 20:61885728-61885750 GATTAGATGCTGTGGGAGGAGGG - Intronic
1176057097 20:63154711-63154733 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1176057114 20:63154763-63154785 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1177584852 21:23077971-23077993 TAATGGACACAGAGAGAGGATGG + Intergenic
1177787085 21:25682804-25682826 GAAGGGATGGAGTGGGAAGATGG + Intronic
1177963890 21:27703276-27703298 GAATGGGTGCAGATGAAGGAGGG - Intergenic
1179061452 21:37983146-37983168 GAAAGGAGGGAGGGGGAGGAAGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179646960 21:42782028-42782050 GAAGGGAGGCAGAGGAGGGAGGG - Intergenic
1179882526 21:44299594-44299616 GAAAGGAGGGAGAGGGAGGGAGG + Intergenic
1180092743 21:45541451-45541473 GAATGCATCCAGAGGGAAGGTGG - Intronic
1180184505 21:46132757-46132779 GGATGGCTGCAGGGGGAGGGAGG - Exonic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1181350044 22:22248424-22248446 GACTGCATGCAGCAGGAGGATGG - Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181918630 22:26301532-26301554 GGAATGATGCAGAGTGAGGATGG + Intronic
1181994829 22:26869065-26869087 CTATGGATGGAGAGGGAGTAGGG + Intergenic
1182253192 22:29018295-29018317 GATTGGATGTGGAGAGAGGAAGG + Intronic
1182549414 22:31092932-31092954 AAATGGAGGCACAGGGAGGCAGG - Intronic
1183162798 22:36126366-36126388 GAAAGGAGGGAGAGGGAGGAAGG - Intergenic
1183162805 22:36126388-36126410 GAAAGGAGGGAGAGGGAGGAAGG - Intergenic
1183162812 22:36126410-36126432 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183162889 22:36126718-36126740 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183162895 22:36126740-36126762 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183354933 22:37353161-37353183 GACTGGATGCAAGAGGAGGAAGG - Intergenic
1183467260 22:37986012-37986034 GAAGGGAGGCGGGGGGAGGAGGG - Intronic
1183883477 22:40856790-40856812 GAATGTATGCGCAGGGAGGCAGG - Exonic
1184239346 22:43203770-43203792 GAAGGGAGGCAGAGGGAGGGAGG + Exonic
1184291798 22:43501367-43501389 GAAAGAAGGAAGAGGGAGGAGGG - Intronic
1184600243 22:45539137-45539159 GAAGGGAAGGAGGGGGAGGAGGG - Intronic
1184620795 22:45674634-45674656 AGATGGATCCAGGGGGAGGATGG + Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185399964 22:50610599-50610621 GGATGGCTGCAGAGGGAGGAAGG + Intronic
949104035 3:181914-181936 GAATGGATGAATAGGTAGGTGGG - Intergenic
949306256 3:2644457-2644479 GAATGAATGCTGAGGGAAAAGGG + Intronic
949571016 3:5293286-5293308 GATTGGAGCCTGAGGGAGGATGG + Intergenic
949869090 3:8571563-8571585 GGATGGAGACAAAGGGAGGATGG + Intergenic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950418744 3:12884262-12884284 GCATGGCTGATGAGGGAGGAGGG - Intergenic
951114621 3:18845514-18845536 GAATGAAAGCAGAGGAGGGAAGG - Intergenic
951114625 3:18845539-18845561 GAATGAAAGCAGAGGAGGGAAGG - Intergenic
951616021 3:24545042-24545064 CAAAGGATTCAGAGGGAGCATGG + Intergenic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
951860294 3:27244616-27244638 GCAGGGTTGCAGAGGGAGAATGG - Intronic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
952355956 3:32584172-32584194 AGATGGAGGAAGAGGGAGGAAGG - Intergenic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
953026009 3:39145357-39145379 AAATGGGTGGAGAGGGAGGAGGG - Intronic
953199399 3:40765390-40765412 GAAGGGATGGAATGGGAGGAGGG - Intergenic
953230268 3:41058383-41058405 GGAGGGAGGAAGAGGGAGGAGGG + Intergenic
953284765 3:41595915-41595937 GAATAGCTGCAGAGGGATGTGGG + Intronic
953958167 3:47247252-47247274 GAATGGGTGCAGTGGGTGGAGGG - Intronic
954681526 3:52348714-52348736 GGAGGGATGCAGCGGGAGAAGGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955445507 3:59006147-59006169 GGATGGATGGACGGGGAGGAGGG + Intronic
956140180 3:66138631-66138653 GGATTGATGCAGGGGGAGGGGGG + Intronic
956715972 3:72080409-72080431 GAAGAGATGGGGAGGGAGGAAGG - Intergenic
957017935 3:75091618-75091640 AAATGGAGGAAGATGGAGGAAGG - Intergenic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
957887480 3:86307268-86307290 GAATGGATGCGGGAGGAAGAGGG - Intergenic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
960290382 3:115877293-115877315 GAATGAAGGCAGAGGCATGAGGG - Intronic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961508433 3:127387207-127387229 GGATGGATGCCGCGGGGGGATGG - Intergenic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962384939 3:134925323-134925345 GAATGTGTGGAGAGGAAGGAGGG + Intronic
962453520 3:135542780-135542802 TCATGGATGCAAAGGGAGGAAGG - Intergenic
962559629 3:136592045-136592067 GAATGGAAGGAAAGGGAGGAAGG + Intronic
962823247 3:139073561-139073583 GAATGGATAAAGAGGGAGGGGGG + Intronic
962830733 3:139136949-139136971 GAATGGATGCAGATACAGGCAGG - Intronic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964291074 3:155180622-155180644 GAAAGGGTGTGGAGGGAGGAAGG + Exonic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
964824149 3:160806861-160806883 GAAAGGAAGGAAAGGGAGGAAGG + Intronic
965285342 3:166812022-166812044 GGAGGGATGTGGAGGGAGGAAGG + Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
966226097 3:177599704-177599726 GAATGGAGCAAGAGGAAGGAAGG + Intergenic
966845815 3:184128905-184128927 GCTTGAATCCAGAGGGAGGATGG - Intergenic
966882620 3:184358825-184358847 GAAGGGAAGAAGGGGGAGGATGG + Intronic
966912867 3:184569122-184569144 GAAGTGAGGGAGAGGGAGGAGGG + Intronic
967332136 3:188301095-188301117 GACTGGATAGAGAGGCAGGAGGG - Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
968916658 4:3499707-3499729 GAGGGGATGCAGAGGGAGCGTGG + Intronic
969232950 4:5844375-5844397 GAATGGAGGGAAGGGGAGGAAGG + Intronic
969272785 4:6114157-6114179 GAATGAATGCAGAGCGAGGAGGG + Intronic
969308846 4:6340528-6340550 GATTGGATGGAGAGGGAGGGAGG - Intronic
969492717 4:7509297-7509319 GAGGGGATGGAGAGGGAGAAAGG + Intronic
969495330 4:7523089-7523111 GGGAGGAGGCAGAGGGAGGAGGG - Intronic
969621035 4:8279000-8279022 GAAGGGATGGAGGGGGAGGAGGG - Intronic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
970007951 4:11428547-11428569 GAGTGGATGCAGAGGGAACCAGG - Intronic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
971440790 4:26682796-26682818 GAAAGGAAGAAGGGGGAGGAGGG - Intronic
971521635 4:27559738-27559760 GCTTGGAAGCTGAGGGAGGATGG + Intergenic
971839640 4:31834821-31834843 GAACTGAGGCAGAGGGAGGTGGG - Intergenic
972061016 4:34873564-34873586 GAATGGATCAAGAGGAAGAAAGG + Intergenic
972123254 4:35732110-35732132 GAATGGAGGCAGGAGAAGGATGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
975739057 4:77410729-77410751 GAAAGGATGCAAAGGGGTGAGGG - Intronic
977296900 4:95220358-95220380 GGATAGATGCAGAGTGAGAAAGG - Intronic
977505242 4:97893813-97893835 GAATGGATGTTGAGGGAGACAGG + Intronic
977870165 4:102081605-102081627 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
977924548 4:102685460-102685482 GAAAGGATGCAGCTTGAGGATGG - Intronic
978483020 4:109216239-109216261 TAATGGATGGATAGGAAGGAAGG + Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
980495822 4:133586841-133586863 GAGTAGCTGCATAGGGAGGATGG - Intergenic
980862310 4:138514171-138514193 GTAGGGATGGAGAGGGAGAATGG - Intergenic
981054598 4:140347433-140347455 GAGTGGAAGCATAGGAAGGAAGG - Intronic
981466607 4:145079730-145079752 GCATGGATGCAGCTGGAGGCCGG + Intronic
982162369 4:152583165-152583187 GAATGGCTGAAGAAGCAGGAAGG - Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
982969762 4:161969947-161969969 GATTCGATGCAGAGGGTGAAAGG + Intronic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
984657504 4:182335085-182335107 GAATGAACGCACAGGTAGGAAGG + Intronic
984858913 4:184219763-184219785 GAAAGGAAGAAAAGGGAGGAAGG + Intronic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985958064 5:3279049-3279071 GAATGGGAGGAGAGGAAGGAGGG - Intergenic
986636076 5:9823637-9823659 GAAGGGAGGGAAAGGGAGGAAGG + Intergenic
987365647 5:17146595-17146617 GAAGGGAAGGAGAGGAAGGAGGG - Intronic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
987727711 5:21724041-21724063 GAATGGATTGATAAGGAGGAAGG - Intergenic
987729668 5:21752786-21752808 GAAAGGAAGTAGAGGAAGGAAGG + Intronic
988801191 5:34698136-34698158 GAAGGGAGGCAGAGAGGGGAGGG - Intronic
989110209 5:37899844-37899866 GAATTCATGCAGAGTGACGAAGG - Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989979162 5:50621657-50621679 GAAAGGAAGAAGAGGAAGGAAGG + Intergenic
991646735 5:68808154-68808176 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
991945223 5:71892906-71892928 GCGTGGATGCTGTGGGAGGAAGG + Intergenic
992127687 5:73658509-73658531 GAATAGATGCAGAGCCAGAAAGG + Intronic
992941440 5:81766299-81766321 GAATGGAGGAAAAAGGAGGAAGG + Intergenic
993160730 5:84287807-84287829 GAATGGCTAGAGAAGGAGGAGGG - Intronic
993632936 5:90309504-90309526 GAAGGGAAGGAGAGGGAGGGAGG + Intergenic
994106914 5:95959712-95959734 GAGTGCATGCACAGGGAGAAAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994512868 5:100729408-100729430 GAATGCATGCAAAAGGAAGAGGG - Intergenic
994670099 5:102754470-102754492 AAAGGGATGCAGATGGAGGCGGG + Intronic
995164478 5:109023039-109023061 AAATGTATGTAAAGGGAGGATGG + Intronic
995549119 5:113263295-113263317 GAATGGAAGCCGAAGGAAGAAGG + Intronic
995618685 5:113998258-113998280 GAATGGATGGAAAGGAAAGATGG - Intergenic
995793171 5:115915409-115915431 GAATGGAAGGGGAGGAAGGATGG - Intergenic
995821577 5:116240322-116240344 GAATGGAGGCAAAGGAAAGAAGG + Intronic
996365797 5:122699792-122699814 GGATGGAAGCAGAGGGAGAAAGG - Intergenic
996557138 5:124790067-124790089 GAAGGGAGCCAGAGGGTGGACGG - Intergenic
996672534 5:126135111-126135133 GGATGGATGCAGAGCTAGAAAGG + Intergenic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
998352281 5:141509289-141509311 GGGTGGAGGCAGAGGGAGGCTGG + Intronic
998506942 5:142679677-142679699 GAAAGAGTGAAGAGGGAGGAAGG - Intronic
999375843 5:151085950-151085972 GAATGGAGGGAGAGCGGGGAGGG - Intronic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999869483 5:155734307-155734329 GGAAGGCTGCAGTGGGAGGATGG - Intergenic
999958062 5:156723943-156723965 GAATGGATGGGAAGGGAGCACGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000922061 5:167149944-167149966 GAAGGGAAGGAGAGGAAGGATGG + Intergenic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001388171 5:171357153-171357175 GAATGGATACTAAGGGATGAAGG + Intergenic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1002081944 5:176742644-176742666 GAATGGATGCAGAGTGCTAAGGG + Intergenic
1002630811 5:180575740-180575762 AAATGAATGCAGAGGGAGCTTGG + Exonic
1002895349 6:1376901-1376923 GGATGGAGGCTGAGGGAGGCAGG - Intergenic
1003020922 6:2508774-2508796 GGATGGATGGACAGGGAGAAGGG + Intergenic
1003389820 6:5703960-5703982 GGAAGGAGGAAGAGGGAGGAAGG - Intronic
1003464861 6:6369256-6369278 GAAGGAAGGGAGAGGGAGGAGGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1004265131 6:14142720-14142742 GAACAGATTCAGAGGGAGCATGG + Intergenic
1004292698 6:14382940-14382962 GAAAGGAAGAAGAGGAAGGAAGG - Intergenic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1004722023 6:18276030-18276052 GAAGAGGTGAAGAGGGAGGAGGG - Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005601825 6:27433955-27433977 GAAGGGAGGGAGAGGAAGGAAGG - Intergenic
1005976619 6:30804978-30805000 GAAGAGATGCACAGGGAGAAGGG + Intergenic
1006828868 6:36956835-36956857 GAATGGATCCAGGGTGAGGCAGG + Intronic
1006994475 6:38245509-38245531 AGAGGGATGCAGAGGGAGTATGG + Intronic
1007282264 6:40721303-40721325 AAATGGATGCAGTGGTGGGATGG - Intergenic
1007510374 6:42370117-42370139 GGATGGATGCAGGGGAAGGGGGG + Intronic
1007517987 6:42428837-42428859 GAAGGGAGGGAGAGGGAGGCAGG - Intronic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007835685 6:44671878-44671900 GCAGGGATGCAAAGGGAGCAGGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008262593 6:49385465-49385487 GAATGGAAACAGAGGAAGCAAGG + Intergenic
1008410311 6:51170913-51170935 GCAAGGATGCAGAGAGAGGGGGG + Intergenic
1009411863 6:63374693-63374715 AAATGGATCCACAGGGAGGCTGG + Intergenic
1009590373 6:65661938-65661960 GAAAGGATGGAGAGGCAAGAAGG + Intronic
1010001282 6:70952589-70952611 GATAGGATGCACAGGGAGGCAGG + Intronic
1010450068 6:75992531-75992553 GCATGGATACAAAGGAAGGAAGG - Intronic
1011278896 6:85657113-85657135 GAAAGGTTTCAGAGGGAGCATGG - Intergenic
1011632339 6:89339551-89339573 GAAGGGATGGGGAGGGAAGAGGG + Intronic
1012401602 6:98846064-98846086 GAAAGAATGTAGAGTGAGGAAGG - Intergenic
1013300134 6:108797387-108797409 GAATGAATGCAGTGGGAGCAGGG - Intergenic
1014697008 6:124635025-124635047 GAAAGGAAGAAGAGGAAGGAAGG + Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015692107 6:135936989-135937011 GAAGGGAGTCAGAGTGAGGAGGG + Intronic
1016241425 6:141935722-141935744 GAGGGGATGCAGATGGAGGTGGG + Intergenic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1016448687 6:144158429-144158451 GAATAGTTGCAGATGGGGGATGG + Intronic
1016519948 6:144936069-144936091 GAATGGAAGCAGAGGGTGGGAGG - Intergenic
1017729776 6:157305200-157305222 GAATGGATGTGGAGAGATGAAGG + Intronic
1018573444 6:165233941-165233963 GGAGGGAAGCAGAGGCAGGAAGG - Intergenic
1018635327 6:165855037-165855059 GAATGAATGAAGAGGGAAGGAGG + Intronic
1018751114 6:166807474-166807496 GAAGAGATGGAGAGGGAGCAGGG - Intronic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1019103413 6:169650096-169650118 GGATGGATGGAGGGGAAGGAGGG - Intronic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019483571 7:1277271-1277293 GGAAGGAGGGAGAGGGAGGAGGG - Intergenic
1019609379 7:1929234-1929256 GGAGGGAGGCAGGGGGAGGATGG - Intronic
1019776113 7:2913000-2913022 GGAGGGAAGAAGAGGGAGGAGGG + Intronic
1019781393 7:2942316-2942338 GAAGGAAGGAAGAGGGAGGAAGG - Intronic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1020080064 7:5282326-5282348 GGAGGGAGGGAGAGGGAGGAGGG + Intronic
1021080494 7:16358259-16358281 AAAGGGATGCTGTGGGAGGAGGG - Intronic
1021503359 7:21354190-21354212 GAATGGATGAGGCGGCAGGATGG - Intergenic
1021569658 7:22051805-22051827 GAAGGGACGAAGAGGGAGGGGGG + Intergenic
1022322889 7:29303594-29303616 GAATGGATGGAGGTGGTGGAAGG - Intronic
1022485391 7:30773662-30773684 GCAGGGTGGCAGAGGGAGGATGG - Intronic
1022614464 7:31915080-31915102 GATTGGTTCCAGAGGGATGATGG - Intronic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022649721 7:32263320-32263342 GTATATATGCAGGGGGAGGAGGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023518463 7:41027212-41027234 GCGTGGATGCAGGGTGAGGATGG - Intergenic
1023816660 7:43955760-43955782 GAATGGAAGCAGGGGAAGAAGGG - Exonic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1024505304 7:50157480-50157502 AAATGGCTGCAGAGGTGGGAAGG - Intronic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025198856 7:56949890-56949912 GGAGGGAGGGAGAGGGAGGAGGG - Intergenic
1025257618 7:57395845-57395867 GGAAGGATGAAGTGGGAGGATGG + Intergenic
1025673090 7:63627043-63627065 GGAGGGAGGGAGAGGGAGGAGGG + Intergenic
1025875547 7:65477276-65477298 GAAAGGTTGGAGAGGGAGAACGG - Intergenic
1025998782 7:66545171-66545193 GGCTGGCTGCAGAGGGAGGGAGG - Intergenic
1026306860 7:69150023-69150045 GGAGGGTTGGAGAGGGAGGAGGG - Intergenic
1026760932 7:73125181-73125203 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1026827138 7:73591530-73591552 GTATGCATGCAGAGAGTGGATGG - Intergenic
1026844536 7:73690791-73690813 GAAGGGAAGCTGTGGGAGGAGGG + Intronic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1027037274 7:74933977-74933999 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1027086288 7:75267475-75267497 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1027397180 7:77767849-77767871 GAATGAAAGGAGAGGGAGGGGGG - Intronic
1028829770 7:95314414-95314436 GGAAGGAAGGAGAGGGAGGAAGG + Intronic
1028958515 7:96721850-96721872 GAATGGTTGCCCAGGGAGGCTGG - Intergenic
1028980922 7:96967336-96967358 GAAGGGAAGGAGAGGGAGAAAGG + Intergenic
1029371411 7:100153379-100153401 GACTGCATGCAGACGGAGGAGGG - Exonic
1029392591 7:100285502-100285524 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1030273545 7:107695320-107695342 GAATGGGTGGAGAAGGGGGAGGG + Intronic
1030840466 7:114346777-114346799 GACTGGATGGAGAGAGGGGAAGG + Intronic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1032472596 7:132189389-132189411 GAATGGAGGTAGAGGGAAGGGGG + Intronic
1032530407 7:132615286-132615308 GAGTGGTGGCAGAGGGAGCAGGG + Intronic
1032685765 7:134231907-134231929 GAAGGGATGGGAAGGGAGGAAGG - Intronic
1032879239 7:136071504-136071526 GAATGGAAGTTGAGGGAGAATGG + Intergenic
1033266152 7:139888901-139888923 GAAGGGGTGCAGGGGGAGGATGG + Intronic
1033528373 7:142239699-142239721 GAAGGTATGGAGAGGGAGGGAGG + Intergenic
1033724609 7:144101202-144101224 GAATCCATGCAGAGGAGGGAAGG - Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1034083702 7:148304035-148304057 GAATGTATCTAGAGGGAGGGAGG - Intronic
1034285845 7:149882499-149882521 GAATGGCTGCACAGGAAGGAAGG - Intergenic
1034329192 7:150268461-150268483 GAGTGTATTCAGAGGGCGGAAGG - Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034605276 7:152307180-152307202 GAAGGAAAGAAGAGGGAGGAAGG + Intronic
1034607370 7:152329654-152329676 GAAGGGATGGAGGGGAAGGAGGG + Intronic
1034668862 7:152841399-152841421 GAGTGTATTCAGAGGGCGGAAGG + Intronic
1034721468 7:153298076-153298098 GAATGAATGAAGAAGGAGTAGGG + Intergenic
1034952076 7:155305389-155305411 GAACGGATGCAGCAGGAGGGAGG - Intronic
1034977421 7:155456572-155456594 GAAAAGATGAAGAGAGAGGAGGG + Intergenic
1035149021 7:156850986-156851008 GAATGGATAAAGAGAGAGAAAGG - Intronic
1035722483 8:1802485-1802507 GACTGGAGTCAGAGTGAGGAAGG + Intergenic
1035923462 8:3703425-3703447 GAATGAATGAAAAGGGAGAAAGG - Intronic
1035994883 8:4534579-4534601 GAATGGGGAAAGAGGGAGGAGGG - Intronic
1036037870 8:5040218-5040240 TTATGGATGCAGAGTGAGGTAGG + Intergenic
1036546090 8:9771321-9771343 GAAAGGAGGGAGAGAGAGGAAGG + Intronic
1036612968 8:10365904-10365926 GCAAGTATGCAGAGGTAGGAAGG - Intronic
1036792854 8:11734430-11734452 GAGTGGATGCAGTGAGATGATGG - Intronic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1037759602 8:21733211-21733233 GAGTGGCTGCAGCCGGAGGAAGG - Intronic
1038261173 8:25996188-25996210 GGAAGGCTGCAGTGGGAGGATGG + Intronic
1038573661 8:28685408-28685430 GAAAGGAGGAAGAGGGAGAAGGG - Intronic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1041045030 8:53880545-53880567 GAATGAAGGGAGCGGGAGGAAGG - Intronic
1041540832 8:58983016-58983038 GAAAGGCTGCAGAAGAAGGATGG - Intronic
1042207174 8:66340978-66341000 GATATGCTGCAGAGGGAGGAAGG - Intergenic
1042903953 8:73754541-73754563 CACTGGATGCACAGAGAGGATGG - Intronic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1043917598 8:85940556-85940578 GAAGGGCTGGAGAAGGAGGAAGG + Intergenic
1043971467 8:86533885-86533907 GAATAGATACAAAGGAAGGAAGG - Intronic
1044330454 8:90913991-90914013 GGCTGGATGCAGGGGGAGGCAGG + Intronic
1044520064 8:93189057-93189079 GAATGGAGAGAGAGGGAGGGAGG + Intergenic
1044561348 8:93615540-93615562 GGATGGCTCCAGTGGGAGGAGGG - Intergenic
1044705395 8:95003696-95003718 GAATGTTTGCAGAAGGAGAAAGG - Intronic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045429293 8:102098262-102098284 GAAGGACTGCAGAGGGTGGAGGG + Intronic
1045754611 8:105528103-105528125 AAATGGATGCAGAGGGCTGCAGG + Intronic
1046098703 8:109590040-109590062 GGATGGGTGGAGAAGGAGGATGG - Intronic
1046756534 8:117978385-117978407 GAAAGCCTGCAGATGGAGGATGG - Intronic
1046993358 8:120486649-120486671 TATTGGAAGCCGAGGGAGGAGGG + Intronic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048322062 8:133407735-133407757 GAATGTATGCAAAGGGAGGCAGG + Intergenic
1048592516 8:135833917-135833939 GAATGAATGGAGAGGATGGATGG - Intergenic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1049510942 8:143026370-143026392 GAACAGATCCGGAGGGAGGAGGG + Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1051356504 9:16244042-16244064 TAAAGGATGCAGGGGGAGGAGGG - Intronic
1052140932 9:24982213-24982235 GAATGGTGCCAGTGGGAGGAGGG + Intergenic
1052806793 9:33020336-33020358 GACTTGATGCAGAGGTAGGGAGG - Intronic
1052989213 9:34508979-34509001 GAATGAATAAGGAGGGAGGAAGG - Intronic
1053135484 9:35647871-35647893 GTAGGGATGCAGAGGAGGGATGG - Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1053444709 9:38143116-38143138 GAAGGCAGGCTGAGGGAGGATGG - Intergenic
1053516522 9:38735053-38735075 GAAGGGAGGGAGAGGAAGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055677771 9:78682781-78682803 GGAAGGAAGCAGAGGAAGGAGGG - Intergenic
1056128748 9:83563559-83563581 TAATGGAACCAGAGGAAGGATGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056177473 9:84049367-84049389 GAAGAGATGCAGAGAAAGGAAGG - Intergenic
1056377001 9:86024491-86024513 GAATGGTTGAAAAGGGAGGCAGG + Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057226662 9:93296458-93296480 GGAAGGATGAAGAAGGAGGAAGG - Intronic
1057226763 9:93296777-93296799 GGAAGGATGGAGGGGGAGGAAGG - Intronic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057854761 9:98593825-98593847 GAGTCGCTGCAGAGGGAGCATGG - Intronic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058859132 9:109097374-109097396 GTAAGAATGCAGAGGGAGGTTGG + Intronic
1059241533 9:112810459-112810481 GAATGGATGCTGAGTAAAGAAGG + Intronic
1059346007 9:113628477-113628499 GAATGGAAGCGGAGGTAGGCTGG - Intergenic
1059419841 9:114184037-114184059 GAATGGCTGGAGAGATAGGAGGG + Intronic
1059947122 9:119420823-119420845 TAATTGATGCAGAGGAAGGAAGG + Intergenic
1059993916 9:119891234-119891256 GAAGGGCTGCAGAGAGAGGACGG - Intergenic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061942606 9:133891567-133891589 GAAGGGATGGAGGGGAAGGAGGG + Intronic
1061942652 9:133891684-133891706 GAATGGAAGGGGAGGGATGAAGG + Intronic
1062049923 9:134442008-134442030 GAATGGACCCCGAGGGAGGGCGG + Intergenic
1062150788 9:135017937-135017959 GAAGGGAGGGAGGGGGAGGAAGG + Intergenic
1185485822 X:481428-481450 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485836 X:481483-481505 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485842 X:481512-481534 GGAAGGAGACAGAGGGAGGAAGG + Intergenic
1185485901 X:481707-481729 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485906 X:481724-481746 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485941 X:481837-481859 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485946 X:481854-481876 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485989 X:482009-482031 GGAAGGAAGGAGAGGGAGGAAGG + Intergenic
1185517062 X:708116-708138 GAAGGGAGGGAGAGGAAGGAAGG - Intergenic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185661916 X:1735173-1735195 GAAGGGAAGGAGGGGGAGGAGGG - Intergenic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1186031930 X:5377639-5377661 GAGTGGAGGGAGAGGGAGAAAGG + Intergenic
1187094002 X:16127442-16127464 GCATGGGAGGAGAGGGAGGATGG - Intronic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1187897287 X:23994185-23994207 GAAGGGATCCAAAGGGAGAATGG + Intronic
1188274871 X:28187706-28187728 GAATGGATACAGAGGATGAACGG - Intergenic
1188480063 X:30628301-30628323 GAATGAGTGCAGGGTGAGGAGGG - Intergenic
1188869157 X:35352670-35352692 GAATGCATGCTGGTGGAGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190059757 X:47203110-47203132 TAAGGAATGCAAAGGGAGGAGGG - Intronic
1190154106 X:47973726-47973748 GATTGGAGGAAGAGAGAGGAGGG - Intronic
1190214766 X:48472671-48472693 GAATGGATGCAGAGGGGAGGGGG - Intergenic
1190792700 X:53714852-53714874 GAGTGAATGTAGAGGGAGGTAGG + Intergenic
1192365760 X:70471693-70471715 GATTGGATGTAGAGTGAGAAAGG - Intronic
1192915904 X:75651227-75651249 TAATTGATCAAGAGGGAGGAAGG - Intergenic
1193401531 X:81050620-81050642 GAATAGAAGAAGAGGGAGAAAGG - Intergenic
1194297563 X:92144765-92144787 AAATTGATGCAGAGGGATGAAGG + Intronic
1195951920 X:110284173-110284195 AAATGGCTCCAGAGGCAGGAGGG + Intronic
1196195100 X:112831294-112831316 GAATAGATGGAGAGGGATTAGGG - Intronic
1196819017 X:119688219-119688241 GAATGGAGGCAGAGGGTGACAGG - Intronic
1197927061 X:131657548-131657570 GAATGGATCAAGAGGAAGAAAGG + Intergenic
1198041734 X:132859657-132859679 GAAGGGAGGAAGAGGGAGGGAGG + Intronic
1198416526 X:136425703-136425725 GAATGGTTGGAGAGGTAGGAAGG + Intergenic
1198522959 X:137471285-137471307 GAATGAATGAATTGGGAGGAAGG - Intergenic
1198770812 X:140127844-140127866 GGAAGGAAGAAGAGGGAGGAGGG + Intergenic
1199073904 X:143509246-143509268 GAAGGAATGCAGGTGGAGGAAGG + Intronic
1199215422 X:145255565-145255587 GAAGGAATGCAGGTGGAGGAAGG - Intronic
1199589888 X:149457546-149457568 GAATGGAGACAGAGGGGAGATGG + Intergenic
1199814494 X:151385950-151385972 GAAAGGAAGGAGAGGAAGGAAGG - Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1199905865 X:152229115-152229137 GAATCCATGAAGAGGGAGAAAGG - Intronic
1200067462 X:153510726-153510748 GAAAGGAGGCACAGGAAGGATGG - Intergenic
1200615137 Y:5369666-5369688 AAATTGATGCAGAGGGATGAAGG + Intronic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146526 Y:11067855-11067877 GAATGGAAGGAGGGAGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201274702 Y:12286620-12286642 GAAAGGTTGGAGAGGGAGAAGGG + Intergenic
1201741124 Y:17325531-17325553 GAATAGAGGGAGAGGGAGGGAGG + Intergenic