ID: 979669367

View in Genome Browser
Species Human (GRCh38)
Location 4:123346097-123346119
Sequence AATGCTGGAGTTGCTTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979669363_979669367 10 Left 979669363 4:123346064-123346086 CCTCTTTAGTTGCTCTTTTGATT No data
Right 979669367 4:123346097-123346119 AATGCTGGAGTTGCTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979669367 Original CRISPR AATGCTGGAGTTGCTTATTG TGG Intergenic
No off target data available for this crispr