ID: 979671717

View in Genome Browser
Species Human (GRCh38)
Location 4:123366607-123366629
Sequence CTAGAGCAGCAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979671716_979671717 7 Left 979671716 4:123366577-123366599 CCACGTGTGCAGGAAGAAGTCTA No data
Right 979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979671717 Original CRISPR CTAGAGCAGCAGCAGCAGAG AGG Intergenic
No off target data available for this crispr