ID: 979674521

View in Genome Browser
Species Human (GRCh38)
Location 4:123397675-123397697
Sequence CCGGGCACTCCGGTCCCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979674521_979674537 28 Left 979674521 4:123397675-123397697 CCTGCCGGGACCGGAGTGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 97
Right 979674537 4:123397726-123397748 GCGGAATCGGCTAAGCGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 7
979674521_979674534 15 Left 979674521 4:123397675-123397697 CCTGCCGGGACCGGAGTGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 97
Right 979674534 4:123397713-123397735 ACTTGCCCAACGTGCGGAATCGG 0: 1
1: 0
2: 0
3: 2
4: 30
979674521_979674529 9 Left 979674521 4:123397675-123397697 CCTGCCGGGACCGGAGTGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 97
Right 979674529 4:123397707-123397729 GCCCCCACTTGCCCAACGTGCGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979674521 Original CRISPR CCGGGCACTCCGGTCCCGGC AGG (reversed) Exonic
900393633 1:2444299-2444321 CCGGGCACCCCGATCCCTGCCGG + Intronic
900516376 1:3084180-3084202 CCTGGGACTGCGGTCCTGGCGGG + Intronic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
901676599 1:10889101-10889123 CCCGGCACGCCCGCCCCGGCTGG + Intergenic
905767107 1:40610346-40610368 CCGGCCACTCTGGCACCGGCAGG - Intergenic
906950759 1:50333186-50333208 CCGGGCGCTCCGCTCCCAGCCGG + Intergenic
915915576 1:159938435-159938457 CGGGGCACTCCAGTCCCAGCTGG + Intronic
920002314 1:202808206-202808228 CCGGGCACTCGGGTGGAGGCAGG + Exonic
921472696 1:215567626-215567648 CCGGGCTCGGCGGTCCCGGCTGG + Exonic
922250593 1:223845857-223845879 CCGGGCTCCCCCGCCCCGGCCGG + Exonic
922460253 1:225810184-225810206 CCGGGGAGTGCGGGCCCGGCCGG - Intronic
922588122 1:226751194-226751216 CCTGGAACCCCAGTCCCGGCGGG - Intergenic
922750144 1:228066353-228066375 CAGGGCACTCAGGTCCCTGTCGG + Intergenic
1070771586 10:79085468-79085490 CCTGGCACTCAGGTGCCGTCTGG + Intronic
1072916669 10:99540993-99541015 CGGGGCACTCCCGGCCCAGCTGG - Intergenic
1072982976 10:100115226-100115248 GCGGGCGCCCCGGACCCGGCCGG + Intergenic
1073095600 10:100977857-100977879 CAGGGCACTCCAGTGGCGGCGGG + Intronic
1073196407 10:101695059-101695081 CCGGGCCCGCCGTTCCCGGGGGG + Exonic
1073287303 10:102396652-102396674 CCAGGCACTGCGGTCACTGCTGG + Intronic
1075438374 10:122461375-122461397 CCGGGCACGGCGGTGCTGGCGGG - Intergenic
1075910757 10:126123689-126123711 CGGGGCACACAGGTCCCGCCTGG - Intronic
1076929957 10:133525604-133525626 CAGGGCACGCGGGTCCCGCCTGG + Intronic
1078524532 11:12090413-12090435 CCCGCTACTCCTGTCCCGGCAGG + Intergenic
1081485106 11:43521581-43521603 CCCGCCACTCCAGTCCCAGCTGG - Intergenic
1084193127 11:67508000-67508022 CCGGGCACCCCGGTCCCTACAGG - Exonic
1084973028 11:72781687-72781709 GCTGGCACCCCGGCCCCGGCGGG - Intronic
1088172928 11:107018183-107018205 CCGGGGACTCCCGCCCCGCCGGG - Exonic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1096791476 12:54047694-54047716 CCGCGCGCTCTGGTCCTGGCGGG - Intronic
1101913735 12:108880088-108880110 CCCTGCACTCCAGTCCGGGCTGG + Exonic
1104702306 12:130916271-130916293 CCCGGCACGCAGGACCCGGCCGG + Intergenic
1105413821 13:20192755-20192777 CCGGGCAGTCCGGGGCCGGCGGG + Intronic
1113385396 13:109843304-109843326 CCTGGCACTCCGGTTCCGGGCGG + Intergenic
1114007955 14:18333711-18333733 TCGGGCACTCCAGGCCCGTCTGG - Intergenic
1114485254 14:23057943-23057965 CCGGGCTCCCGGTTCCCGGCTGG + Intergenic
1122270863 14:100568007-100568029 CCGGGCACAGCGGGCACGGCCGG + Exonic
1122880624 14:104689189-104689211 GCGGGGACTCCGGATCCGGCTGG + Intergenic
1124014324 15:25863062-25863084 CCGGGCTCCTCGGTCCCCGCCGG + Exonic
1124629271 15:31327627-31327649 CCGGGCTCGCCGCTCCCCGCGGG - Exonic
1130002521 15:80059823-80059845 CCGGGCAAGCCGGGCCCCGCGGG - Intronic
1138431979 16:56974917-56974939 CAGGGAACCCCTGTCCCGGCTGG - Intronic
1142112762 16:88340973-88340995 CCGGGCAAAGCGGTCCAGGCTGG + Intergenic
1142631536 17:1229302-1229324 CCGGCCGCCCCGGGCCCGGCGGG + Intergenic
1143608231 17:8003088-8003110 CCGGGCTCTGCGGTCCCGCGTGG + Exonic
1146058775 17:29593773-29593795 CCGGGCACGCCCGTCCGGCCTGG + Intronic
1146635676 17:34502633-34502655 CCTTGCACTCCAGTCCCGGGGGG - Intergenic
1152610534 17:81313125-81313147 CCGGGAGCTCCGGCCCCGGTGGG + Exonic
1155055326 18:22177161-22177183 CCGGGCTCTCCTGGCCCGGCCGG + Intronic
1160680210 19:408823-408845 CCTGGCCCTCCGGTCCAGGGAGG - Intronic
1160703819 19:519884-519906 CCGGGCCCTCCAGCCCCGCCCGG + Intergenic
1160824144 19:1071566-1071588 CCCGGCACTCCGCGCGCGGCCGG - Intronic
1160990136 19:1857074-1857096 CCGGGCCCCCTGGCCCCGGCGGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1163607142 19:18281578-18281600 CCGGGCGCTGCGGCCGCGGCCGG - Exonic
1164389678 19:27806673-27806695 CCGGGCACTCCGCCTCCTGCCGG - Intergenic
1164639167 19:29812109-29812131 CGGCGCGCTCCAGTCCCGGCAGG - Exonic
1166142368 19:40811914-40811936 CCGCGCACTCCATTCCCGACAGG - Intronic
1167251028 19:48398495-48398517 CCGGGCCCACCGGCCCCGCCCGG - Exonic
926285329 2:11483031-11483053 GCGGGCACTCGGCGCCCGGCGGG + Intergenic
927696277 2:25241750-25241772 CCTGGCACCCTGGTCTCGGCAGG + Intronic
935820320 2:106887014-106887036 CGGGGCACTCGGGTCCCGGGCGG + Intronic
946369809 2:219274077-219274099 CTGGGCACTCGGGACCTGGCAGG - Intronic
947549932 2:231038386-231038408 CCGTGCACTCCGGACCCTTCCGG - Intronic
1169496761 20:6123002-6123024 CCGGGCACGCCGCGCCAGGCTGG - Exonic
1171215540 20:23350035-23350057 CCGGGAAACCCGGGCCCGGCTGG - Intergenic
1172101197 20:32484500-32484522 CCGGACACTCGGGTGCCCGCGGG - Intronic
1174057162 20:47806076-47806098 CCGGCCACTTCGGTGCCAGCAGG + Intergenic
1176178693 20:63739938-63739960 CAGCGCACTGGGGTCCCGGCCGG - Exonic
1176264731 20:64203221-64203243 CAGGGCAGTCCGGTCCCCACAGG + Intronic
1178708040 21:34890149-34890171 CCGCGCAGTCCGGGCCCGCCCGG - Intronic
1180432462 22:15264521-15264543 TCGGGCACTCCAGGCCCGTCTGG - Intergenic
1180515035 22:16132501-16132523 TCGGGCACTCCAGGCCCGTCTGG - Intergenic
1180840841 22:18958176-18958198 CCTGACCCTCCGGGCCCGGCTGG - Intergenic
1184778622 22:46635433-46635455 CCGGCCACTCCTGTCCTGGGAGG + Intronic
1184778660 22:46635525-46635547 CCGGCCACTCCTGTCCTGGGAGG + Intronic
1184778679 22:46635571-46635593 CCGGCCACTCCTGTCCTGGGAGG + Intronic
1184879923 22:47298212-47298234 CAGGCTACTCCGGTCCTGGCTGG + Intergenic
950153897 3:10708200-10708222 CCGCGCGCTCCGGTCCCGCGGGG - Intergenic
953911058 3:46893270-46893292 CTGGGCACTCTGGTGCTGGCTGG - Intronic
961013287 3:123449404-123449426 CCGGGCCGGCAGGTCCCGGCCGG - Exonic
968809736 4:2794443-2794465 CCAGGCACTCCACTCCTGGCAGG + Intronic
969715888 4:8867902-8867924 CCAGGCGCTGCGCTCCCGGCGGG + Exonic
969716753 4:8871641-8871663 CCGGGCTCCTCGGTCCCCGCTGG + Exonic
979674521 4:123397675-123397697 CCGGGCACTCCGGTCCCGGCAGG - Exonic
985772368 5:1820886-1820908 CTGGTCACCCCGGTCCCAGCAGG - Intergenic
985966236 5:3340622-3340644 CAGGGCCCTCCTGTCCAGGCTGG - Intergenic
998252160 5:140560693-140560715 CCAGGCATTCCGGTCCCCCCTGG + Exonic
998643895 5:144041701-144041723 CTGGCCACTCCGGTGCCGGCAGG + Intergenic
1006442289 6:34060087-34060109 CCAGGCCCTCCAGTCCCAGCTGG - Intronic
1007932121 6:45700749-45700771 CCGGGCACTCCTGTTGCAGCAGG + Intergenic
1022103695 7:27184013-27184035 GCCGGGACTCCAGTCCCGGCCGG - Intronic
1024228569 7:47346744-47346766 CAGGGCACTCTGGTCCTGACAGG - Intronic
1029537392 7:101164447-101164469 CCGGGCTCTCCGGCGCCGGGAGG + Exonic
1029593033 7:101519919-101519941 CCAGGCCCTCCAGTCCAGGCAGG + Intronic
1029657268 7:101935546-101935568 CCGGGCACTCCTGGCCCAGCTGG + Intronic
1035580746 8:737966-737988 CCCAGCGCTCCGGCCCCGGCGGG - Intronic
1042021359 8:64373578-64373600 CCGGGCTCTGCGTCCCCGGCTGG + Intergenic
1042837725 8:73092972-73092994 CCGGGCGCTGCTGTCCCGGCCGG - Exonic
1049032375 8:140047412-140047434 CCTGGCTCTCCGGTGCCAGCGGG - Intronic
1050094251 9:2047327-2047349 CCGGGCACTGCGGCCGCGGGCGG - Exonic
1053753637 9:41280518-41280540 CCAGGCACTCCGGTCCCTACAGG + Intergenic
1053785842 9:41652286-41652308 CCGGGCAGTCAGGCACCGGCTGG - Intergenic
1054259160 9:62844878-62844900 CCAGGCACTCCGGTCCCTACAGG + Intergenic
1054332618 9:63775159-63775181 CCAGGCACTCGGGTCCCTACAGG - Intergenic
1057259774 9:93577001-93577023 CCGGGCGCCCCGGTCGGGGCTGG + Intronic
1058908565 9:109499954-109499976 CCGGGGGCTCCGGCCCCGCCCGG - Intergenic
1059633898 9:116154246-116154268 CGGGTCTCTCCGGGCCCGGCGGG - Exonic
1061540865 9:131277357-131277379 GCGGGCACCCCTTTCCCGGCTGG + Intergenic
1062447344 9:136600486-136600508 CCCGGAGCTCCGGACCCGGCAGG - Intergenic
1202799623 9_KI270719v1_random:163470-163492 CCAGGCACTCTGGTCCCTACAGG - Intergenic
1185504047 X:619196-619218 CCCCGCACTCCGGCCCGGGCCGG + Intergenic
1188811344 X:34657072-34657094 CCCGGCTCTCCGGACCCGCCTGG - Exonic
1190730886 X:53224844-53224866 CCGGGCACTCCGGTGGCGGTAGG + Exonic
1201966692 Y:19744489-19744511 CCGGGCACTCCGGTGGCGGCAGG + Exonic