ID: 979674874

View in Genome Browser
Species Human (GRCh38)
Location 4:123399066-123399088
Sequence GGCACTGCCACTTTAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979674865_979674874 29 Left 979674865 4:123399014-123399036 CCGCAACTTTCTTCTGGTTTGGA 0: 1
1: 0
2: 10
3: 326
4: 6728
Right 979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979674874 Original CRISPR GGCACTGCCACTTTAAAAGT GGG Intronic
900899258 1:5505878-5505900 GCCATTTCCACTTTTAAAGTGGG + Intergenic
903385864 1:22925973-22925995 GGCAGTGCCACTTAAAATATAGG - Intergenic
903600611 1:24535995-24536017 AGGACGGCCACTTTAGAAGTGGG + Exonic
904206686 1:28860062-28860084 AGCACAGCCACTTTAAATGTTGG + Intronic
907367106 1:53971101-53971123 GGTACTACCTCTTTAAAGGTGGG + Intergenic
909497851 1:76299439-76299461 GTCACTGCAACTTTAAAAAGGGG + Intronic
910325969 1:86007385-86007407 GGCACAGCCACTTTGGAAGACGG + Intronic
911134615 1:94426305-94426327 AGCAATGCCTCTTTAAAAGGTGG - Intronic
912631431 1:111249685-111249707 GGCTCTGCCACCTTACGAGTTGG + Intergenic
917929839 1:179815591-179815613 GCCACTGCCACATTCTAAGTAGG - Exonic
919809011 1:201397514-201397536 GGCACTGGAACTTTGAAAATGGG - Intronic
1064856124 10:19769110-19769132 GCCACTTCTACTATAAAAGTAGG - Intronic
1065757228 10:28942483-28942505 GGCACAACCACTTTGAAAATTGG - Intergenic
1066980429 10:42408698-42408720 GACACTGTCACTTTAAAAAATGG - Intergenic
1069022783 10:63507339-63507361 GGCACAGCCACTTTTAAAGACGG - Intergenic
1070283351 10:75066279-75066301 GGCACTGCCAAGTTGAAGGTTGG - Intergenic
1071119849 10:82264618-82264640 GGCACATCATCTTTAAAAGTCGG + Intronic
1075254945 10:120918320-120918342 GTTGCTGCCACTTTAAAAGAAGG + Intergenic
1078947931 11:16092394-16092416 GGCACTGCCAGTCTTAATGTTGG - Intronic
1081110120 11:39125785-39125807 GGAAATGCCACTTTACAAATAGG + Intergenic
1081790566 11:45780658-45780680 GGCACAGCCACTTTGGAAGACGG + Intergenic
1081809351 11:45906435-45906457 GGAAATGGCACTTTAATAGTTGG - Exonic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1086237138 11:84645085-84645107 GGCACTCCTACTTTCAAAATTGG + Intronic
1089973120 11:122710516-122710538 GGCTCTGCCACTTTTCAGGTGGG - Intronic
1093884301 12:24441555-24441577 GCCACTGCCACTTTATAAAGGGG - Intergenic
1096534413 12:52262115-52262137 GGCTCTGCCACTTACAATGTGGG + Intronic
1096674598 12:53219809-53219831 GGTACTGGCCCTTTAAACGTGGG - Intronic
1097739969 12:63230109-63230131 AGAACTGCCACATTAAAAATAGG - Intergenic
1101047805 12:100828335-100828357 GTCACTGCCACTTGGAAAATAGG - Intronic
1101759586 12:107647850-107647872 GGCTCTGCCACTTAAAAGCTGGG - Intronic
1103974785 12:124695400-124695422 GGAACTGCCACTTGGAGAGTGGG - Intergenic
1106563564 13:30866827-30866849 CCCACTGCCACTTTATAAGCTGG + Intergenic
1113554840 13:111224634-111224656 GACATTGCCACTTTTTAAGTTGG + Intronic
1116907248 14:50415968-50415990 GGCCTTGCCATTTTAAAATTGGG + Intronic
1121293589 14:92797675-92797697 GGCACTGCAAATGTGAAAGTAGG + Exonic
1122290010 14:100675550-100675572 GACCCTGTCACTTTCAAAGTGGG + Intergenic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1133934487 16:10257518-10257540 GGCTCTGCCACTTCCCAAGTAGG + Intergenic
1135648812 16:24187568-24187590 GGAATTGCAACTTTTAAAGTAGG + Intronic
1136107877 16:28043713-28043735 GGTACAGCCACTTTGAAAGACGG + Intronic
1137692564 16:50439511-50439533 GGCACAGCCACTTTGAGAGGCGG + Intergenic
1138036648 16:53613903-53613925 GGCTCTGCCACATTCTAAGTAGG - Intronic
1143386298 17:6532924-6532946 GGCACTGGGACTTTCAAACTCGG - Intronic
1145275246 17:21425190-21425212 GGCACAGCCACTTTGGAGGTTGG + Intergenic
1145313099 17:21711087-21711109 GGCACAGCCACTTTGGAGGTTGG + Intergenic
1145711523 17:26982901-26982923 GGCACAGCCACTTTGGAGGTTGG + Intergenic
1148120603 17:45208003-45208025 GGCTCTGCCACTTTATAAGTGGG + Intergenic
1148180202 17:45600135-45600157 GGAAATGGCACTTTAATAGTTGG + Intergenic
1148268695 17:46245760-46245782 GGAAATGGCACTTTAATAGTTGG - Intergenic
1150626161 17:66842447-66842469 AGCACTGCCACTTATTAAGTGGG - Intronic
1156129975 18:33960868-33960890 GGTACTTCTATTTTAAAAGTTGG - Intronic
1159190423 18:65034781-65034803 ATCACTGCCACTCTAAAAGGGGG - Intergenic
1163272159 19:16260852-16260874 GGCCCTGCCACTTCAAAATGGGG - Intergenic
1165891245 19:39113546-39113568 GGAACTGCCAGTGCAAAAGTGGG - Intergenic
1167264260 19:48475579-48475601 GGCACTGGCACATTCAAGGTCGG + Intronic
1167391757 19:49200093-49200115 GGCGCAGCCATTTTAAAAATGGG + Intronic
932044186 2:68330759-68330781 GGTTCTGCCACCATAAAAGTGGG - Intergenic
932879960 2:75492025-75492047 GGCTCTGCCAATTTAGAAATAGG - Intronic
934962359 2:98687834-98687856 GGCACTCCCACTTTAACTGTGGG + Intronic
936822049 2:116534080-116534102 TGCACTCCTACTTTAAAAGTTGG - Intergenic
939979645 2:148764258-148764280 GGATCTAGCACTTTAAAAGTCGG - Intronic
942269613 2:174261088-174261110 GGCACAGCCACTTTGGAAGACGG + Intergenic
943277824 2:185890807-185890829 GGCATTTCCATTTTAAAAGGGGG + Intergenic
946706579 2:222464257-222464279 ACCACTGCCATTTTTAAAGTGGG - Intronic
947534340 2:230931534-230931556 GGCACTCCCACTTTACAGGGTGG + Intronic
1172325749 20:34033174-34033196 GGCACTCCAACTTTACAAATAGG - Intronic
1174756641 20:53165567-53165589 AGCACTGACACATTAGAAGTTGG - Intronic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1176958913 21:15137847-15137869 GGCATTGCCACACTGAAAGTAGG - Intergenic
1181971844 22:26696743-26696765 GGTGCAGCCACTTTAAAAGATGG - Intergenic
1184375127 22:44107126-44107148 GGCAATGCCAGTTTGGAAGTGGG + Intronic
952723314 3:36555978-36556000 TGCACTGCCACTTGGAAAGGTGG + Intergenic
955479295 3:59373219-59373241 GGTACTGTCACTTTGAAAGATGG + Intergenic
956634612 3:71351362-71351384 GGCACCGACACTTTAGAAGTGGG + Intronic
956651831 3:71511281-71511303 GCAACTGCAACTTTAAAAGTAGG + Intronic
956734820 3:72230337-72230359 GGCGCTGCCTCATTAAAAGCTGG - Intergenic
958052652 3:88367932-88367954 CTCACTGCTACTTTAAAACTAGG - Intergenic
958533661 3:95367231-95367253 GGCATAGTCACTTTAAAAGGTGG - Intergenic
962422181 3:135238440-135238462 GGCACTGCCACTTTCCAGGCAGG + Intronic
965700389 3:171454603-171454625 GGCATTGCCTCATAAAAAGTAGG - Intronic
970507507 4:16746473-16746495 GAAACTGCAACTTTAAAAATGGG + Intronic
974086547 4:57267068-57267090 GGCTCTGCCACTTTAGACCTTGG - Intergenic
976922757 4:90458196-90458218 GGCCCTGCCCCCTTACAAGTTGG - Intronic
978365683 4:107979005-107979027 GGCCCTCCCACTTTAGAAGATGG + Intergenic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
981226766 4:142305503-142305525 GGCTATGCCAGTTTTAAAGTGGG - Exonic
986390362 5:7280180-7280202 AGCACTTACATTTTAAAAGTAGG + Intergenic
994426631 5:99596896-99596918 GGCACTGTCTCTTCAAAAATAGG + Intergenic
1000092593 5:157942786-157942808 GGTACTGCCACTTTGAACTTTGG - Intergenic
1003060342 6:2857847-2857869 GGGGCTGCCATTTTAAAATTGGG + Intergenic
1005883799 6:30079603-30079625 GTCACTGCACCTTTAAAATTTGG - Intergenic
1009818838 6:68773250-68773272 GGCTCTGCCACTTACAAATTGGG - Intronic
1010153141 6:72759893-72759915 GGCACTTCCATTTGAAAAATAGG - Intronic
1010783935 6:79978084-79978106 GACACTGCCTCTATAAAAGGGGG - Intergenic
1011334525 6:86245606-86245628 GGCACTGGGACTTCAAAAGAGGG - Intergenic
1011899383 6:92273573-92273595 GGCACTGCTAATTTAAAAGAAGG + Intergenic
1015294708 6:131577317-131577339 GATACAGCCACTTTGAAAGTAGG + Intronic
1016248290 6:142014199-142014221 GGCATTGGAACTTTAAAAGAAGG + Intergenic
1017298143 6:152823338-152823360 TGCACTGGCATTTTAAATGTTGG + Intergenic
1020916371 7:14198790-14198812 GGCATTGATACTTTAAATGTTGG + Intronic
1022195218 7:28058870-28058892 TGCTCTGCCACTTCAAATGTTGG + Intronic
1026476452 7:70740038-70740060 TGCACAGCCCCTTTAAAAGGAGG + Intronic
1030556672 7:111033384-111033406 GGCACAGCCACTTTGAAAGAGGG + Intronic
1031352865 7:120757046-120757068 GGCTTAGCCACTTGAAAAGTAGG - Intergenic
1031896536 7:127355848-127355870 GGCCCTGCCTATTAAAAAGTTGG - Intronic
1034625619 7:152490105-152490127 GCCTCTGCAACTTTAAAATTGGG - Intergenic
1035154625 7:156902173-156902195 TGCAATGACACTGTAAAAGTTGG + Intergenic
1036474636 8:9082010-9082032 GACACAGTGACTTTAAAAGTTGG - Intronic
1036573668 8:10004142-10004164 GCAACTGACACTTTAAAAATGGG - Intergenic
1040930912 8:52734191-52734213 GGCACTGACAGTCTAAAACTGGG - Intronic
1042502602 8:69525743-69525765 GGCACTGAGACTTTAATGGTGGG + Intronic
1043465239 8:80499519-80499541 GGTACTGTGACTTTAATAGTAGG + Exonic
1046913774 8:119658530-119658552 AGCACTGCCACTTTACTAGCTGG + Intronic
1048502620 8:134992560-134992582 GTCACTGCCACATTGAAAGGAGG - Intergenic
1050962079 9:11747075-11747097 GGCATAGCCACTCTAAAATTCGG + Intergenic
1051824223 9:21200671-21200693 GGAACTTCCACTATTAAAGTGGG - Intergenic
1051825666 9:21215808-21215830 GGAACTTCCACTATTAAAGTGGG - Intronic
1054715252 9:68551043-68551065 ATCACTGCTACTTTAAAAATCGG - Intergenic
1058794518 9:108484846-108484868 GGGACTGCTGCTTTAAAATTAGG - Intergenic
1061438341 9:130580604-130580626 CGCACTGATACTTTAAAAGTTGG + Intronic
1061524847 9:131151349-131151371 GGCACTACCACTTGCTAAGTGGG - Intronic
1187361924 X:18636479-18636501 GGCCCTGCCACTTCCAAACTGGG - Intronic
1188024942 X:25198277-25198299 AGAACTGCCTCTTGAAAAGTGGG - Intergenic
1188787330 X:34364097-34364119 TGCACTGACACTCTGAAAGTAGG + Intergenic
1190406664 X:50094932-50094954 GCCATTGCCACTTTAACAGTTGG + Exonic
1195563475 X:106313232-106313254 GCCACTGGGACTTCAAAAGTGGG - Intergenic
1198285828 X:135190781-135190803 GGCAATGACATTTTAAAAATAGG + Intergenic
1199962919 X:152792743-152792765 GGTACAGCCACTTTCAAAGATGG - Intergenic