ID: 979674976

View in Genome Browser
Species Human (GRCh38)
Location 4:123399655-123399677
Sequence CCCAAAGCAAGCCCACGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979674976_979674985 29 Left 979674976 4:123399655-123399677 CCAGACCGTGGGCTTGCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 979674985 4:123399707-123399729 GATTTCTCAGAAACCTTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 157
979674976_979674980 -2 Left 979674976 4:123399655-123399677 CCAGACCGTGGGCTTGCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 979674980 4:123399676-123399698 GGCTCCCGCGTGGACGCTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 71
979674976_979674984 28 Left 979674976 4:123399655-123399677 CCAGACCGTGGGCTTGCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 979674984 4:123399706-123399728 TGATTTCTCAGAAACCTTGGTGG 0: 1
1: 0
2: 3
3: 23
4: 240
979674976_979674983 25 Left 979674976 4:123399655-123399677 CCAGACCGTGGGCTTGCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 979674983 4:123399703-123399725 TCATGATTTCTCAGAAACCTTGG 0: 1
1: 0
2: 0
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979674976 Original CRISPR CCCAAAGCAAGCCCACGGTC TGG (reversed) Intronic
901641997 1:10697345-10697367 CCCAAAGCCAGGCCACAGTGAGG + Intronic
901864555 1:12095935-12095957 CCCACACCATGCCCACGCTCAGG + Intronic
907611810 1:55878781-55878803 CTCAAAGCAAACTCAAGGTCAGG - Intergenic
911116835 1:94254700-94254722 CACAAAGCAACTCCAAGGTCTGG - Intronic
913957391 1:143318430-143318452 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
914051705 1:144143794-144143816 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
914127492 1:144822747-144822769 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
920565126 1:206967023-206967045 CCCAAACCCAGCCCAGGTTCAGG - Intronic
921939823 1:220828030-220828052 CCCAAAGCCAGCCCCTGGGCAGG + Intergenic
921945093 1:220880498-220880520 CCCCAAGCCAGCCCGGGGTCCGG - Intronic
922586039 1:226736096-226736118 CCCCAAGCAAGCCCAGCGTTGGG + Exonic
922719575 1:227893412-227893434 GCCACAGGAAGGCCACGGTCAGG + Intergenic
1063098067 10:2925800-2925822 CCCAGAGCAAGCCCTCGCTATGG - Intergenic
1066482055 10:35806200-35806222 CCTGAAGCAGGCCCATGGTCTGG - Intergenic
1076280796 10:129244324-129244346 CCCAGAGCAAGCCCAAGCTCCGG - Intergenic
1077733300 11:4759858-4759880 CTCAAGGCAGGCCCACAGTCTGG + Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1081610773 11:44562011-44562033 CCCAAAGCATGATCAAGGTCAGG - Intergenic
1081866641 11:46363867-46363889 CACAAAGCAGGCCCCAGGTCGGG + Intronic
1084012567 11:66360785-66360807 CCCACAGCAAGCCCAGGTTCGGG - Intronic
1089796325 11:120984107-120984129 CCCAAAGCTCACCCATGGTCTGG + Intronic
1091305204 11:134532030-134532052 CCCAAAAGAAGCCCATGGGCAGG - Intergenic
1091646134 12:2273796-2273818 CCCTAACCAAGCCCGGGGTCAGG - Intronic
1096830757 12:54312130-54312152 GCCAAAGCAAGCCCTGGGTTGGG + Intronic
1103595800 12:122023581-122023603 GCCAAACCCAGCCCACGGCCGGG - Intronic
1104960723 12:132487524-132487546 CCCAAAGCAAGCCCTCCCTGGGG + Intergenic
1108220789 13:48232035-48232057 CCCAAAGCAAACTCAAAGTCTGG + Intergenic
1110475691 13:75910803-75910825 CCCAGACCAAACCCAGGGTCAGG - Intergenic
1114625215 14:24124433-24124455 CCCAGAGCAAACCGATGGTCAGG + Exonic
1114780714 14:25535593-25535615 CTCAAAGTAAGCACAAGGTCAGG - Intergenic
1122789245 14:104177388-104177410 CCCAGAGCAGCCCCACGGGCCGG + Exonic
1202930989 14_KI270725v1_random:31660-31682 GCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1123421450 15:20140063-20140085 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
1123530676 15:21146603-21146625 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
1129371377 15:75098084-75098106 ACCCAAACAAGCCCAGGGTCAGG + Intronic
1132749553 16:1451172-1451194 CCCACACCAAGACCACGGCCTGG - Intronic
1133128723 16:3663339-3663361 CCCAAAGGAAGCCCTCGCTGCGG + Exonic
1134058312 16:11183586-11183608 CCCAAGGCAGGCGCACGGCCTGG - Intergenic
1135619755 16:23945544-23945566 CCCAAAGAAAGCCCACAGTGAGG - Intronic
1136403926 16:30032368-30032390 CCCAAAGAAAGGCCAGGGACTGG + Intronic
1137272160 16:46908972-46908994 CCCAAAGGAATCCCATGGCCTGG + Intronic
1137444307 16:48522508-48522530 CCCAGAGCATGCCCAGGATCCGG + Intergenic
1137699092 16:50483030-50483052 CACAAAACAAGCCCAAGGGCTGG - Intergenic
1144808713 17:17984876-17984898 CCCATAGCAAACCCACAGGCAGG + Intronic
1145751415 17:27357490-27357512 CCCTCACGAAGCCCACGGTCTGG - Intergenic
1148321936 17:46761897-46761919 CCCAGAGCATGCCCACTGGCAGG + Intergenic
1150486752 17:65549481-65549503 TCCCAAGCAAGCCCACGGAAGGG + Intronic
1151624325 17:75267228-75267250 CCCAAAGCCAAACCAGGGTCAGG - Intronic
1152132576 17:78485928-78485950 CCCAAAGCAGGGCCACCGACTGG - Intronic
1152230276 17:79110873-79110895 CCCAAAGCAACGCCACAGTGAGG - Intronic
1152342959 17:79735303-79735325 CCCGGAGGTAGCCCACGGTCCGG - Exonic
1152618274 17:81347797-81347819 CCCACAGCAGCCCCAGGGTCTGG + Intergenic
1157649551 18:49313831-49313853 CCCAAAGTTAGCCCTGGGTCAGG - Intronic
1159015555 18:63099333-63099355 AACAGAGCAAGCCCACGCTCAGG + Intergenic
1161038947 19:2099836-2099858 CCCAAAGCGAGGCCACAGTGTGG + Intergenic
1164864253 19:31590788-31590810 CCCACAGCAAGTCTACGGCCTGG - Intergenic
1202691101 1_KI270712v1_random:96218-96240 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
933955292 2:87357733-87357755 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
934239480 2:90253946-90253968 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
934273705 2:91562752-91562774 GCCAGAGCAAGGCCAGGGTCAGG + Intergenic
934461924 2:94217300-94217322 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
943632802 2:190273095-190273117 CTCAAAGCAATCCTACGGCCAGG + Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1173018587 20:39248536-39248558 CCCACAGCAAGCCCACGATGGGG + Intergenic
1174206956 20:48847087-48847109 CCCAAAGCAGGCCCCGGGTGTGG - Intergenic
1175996759 20:62815422-62815444 CCCACCCCAAGCCCAGGGTCTGG - Intergenic
1176046819 20:63097147-63097169 CCCCAGGGAAGCCCAAGGTCAGG + Intergenic
1176593012 21:8660282-8660304 GCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1179447227 21:41440800-41440822 CCTAAAGCAAGTGCAAGGTCAGG + Intronic
1180052135 21:45336055-45336077 CCCAGAGAGAGCCCAGGGTCCGG + Intergenic
1180275859 22:10637409-10637431 GCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1181354326 22:22289469-22289491 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
1183550432 22:38479812-38479834 CAGAAGGCAAGCCCAGGGTCTGG - Intronic
950635409 3:14310984-14311006 CACAAAGGAAGGCCAGGGTCAGG + Intergenic
958815059 3:98905271-98905293 CACAAGGCAAGCCCAGGTTCTGG + Intergenic
968893387 4:3384766-3384788 CCCAAAGTAAGCCCCCTGACAGG - Intronic
969188613 4:5499010-5499032 CCCAAAGCAAGCTCCAGGACGGG + Exonic
969505888 4:7587549-7587571 CCCAAGGCAGGCCCAGGGTCTGG + Intronic
971311669 4:25530472-25530494 CCTAAAGCAAATCCAAGGTCTGG + Intergenic
971327133 4:25653995-25654017 CCAAATGAAAGCCCACAGTCAGG + Intergenic
975847129 4:78536481-78536503 CACAAAGCAAGCAAACGGTGAGG - Intronic
979674976 4:123399655-123399677 CCCAAAGCAAGCCCACGGTCTGG - Intronic
982167330 4:152626037-152626059 CCCAATGCAAGACCACAGCCTGG - Exonic
997048809 5:130353502-130353524 CACAAAGAAAGCCCAGGCTCAGG - Intergenic
997602498 5:135150109-135150131 CCCAAACCCAGCCCACGGCCTGG - Intronic
1002522549 5:179799708-179799730 CCCACAGCAAACCCAGGGGCAGG + Intronic
1006548927 6:34804267-34804289 CCCAAAGGTAGCTCAGGGTCTGG - Intronic
1006595833 6:35192127-35192149 CCCAAAGAAAGCCCAGGCTGGGG + Intergenic
1007689435 6:43689702-43689724 TCCAAAGCAAGCCCTGGGTGGGG - Intergenic
1018095621 6:160384878-160384900 CCCAGAGAAAGCCCACTGTGCGG - Intronic
1018384172 6:163287829-163287851 CCCTCAGCATGGCCACGGTCGGG - Intronic
1018817081 6:167341414-167341436 CACAAAGCAAGCCCAAGTTACGG + Exonic
1023852857 7:44159795-44159817 CCCAAAGCAAGCCTGAGGCCTGG - Intronic
1025283050 7:57642075-57642097 CCCAATACAAGCCCAAGTTCTGG - Intergenic
1029610367 7:101623299-101623321 CACACAGCAAGCACAGGGTCAGG + Intronic
1030070148 7:105691118-105691140 CCCAAAACATGCCCAAGGGCTGG - Intronic
1043173752 8:76998709-76998731 GACAAAGCAAGCCCACCCTCAGG - Intronic
1043379377 8:79686325-79686347 CCCACAGGAAACTCACGGTCTGG + Intergenic
1045175859 8:99724200-99724222 CCCAGAGCAAGCCCAGGGCCTGG - Intronic
1049319973 8:141991102-141991124 CCCCCAGGAAGCCCACGGTGGGG - Intergenic
1049557606 8:143290979-143291001 CCCCAAGGAAGCCCACGCTCGGG + Intronic
1053692407 9:40592984-40593006 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1054272409 9:63044549-63044571 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
1054303649 9:63393902-63393924 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1054402427 9:64720412-64720434 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1054436037 9:65204743-65204765 TCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1054494355 9:65816944-65816966 TCCAGAGCAAGGCCAGGGTCAGG + Intergenic
1057031823 9:91781959-91781981 CCCAACAAAAGCCCACTGTCAGG + Intronic
1058274648 9:103024516-103024538 CCCCATGCAAGTCCACAGTCCGG - Intergenic
1061480546 9:130895868-130895890 CCCAATGGAATCCCAGGGTCAGG - Intergenic
1061819404 9:133217734-133217756 GCCACAGCTGGCCCACGGTCAGG - Intergenic
1062241282 9:135540455-135540477 GCCACAGCTGGCCCACGGTCAGG + Intergenic
1062494901 9:136827059-136827081 CCCAGAGGAAGCCCAGGGCCAGG - Intronic
1203623056 Un_KI270749v1:139089-139111 GCCAGAGCAAGGCCAGGGTCAGG - Intergenic
1193388903 X:80904233-80904255 CCCAAAGCTCACCCATGGTCTGG + Intergenic
1199512075 X:148633647-148633669 TCCAAAGAAAGCCCAAGGTTTGG - Intronic
1200119002 X:153781657-153781679 CCCCAAGCAAGCCCAGGGACAGG - Intronic