ID: 979675301

View in Genome Browser
Species Human (GRCh38)
Location 4:123402786-123402808
Sequence TTGAGGGTATTGAGAGCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979675298_979675301 -9 Left 979675298 4:123402772-123402794 CCTCTGCCATCCACTTGAGGGTA 0: 1
1: 0
2: 2
3: 17
4: 186
Right 979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 197
979675294_979675301 8 Left 979675294 4:123402755-123402777 CCCACTTTCAACAAGAGCCTCTG 0: 1
1: 0
2: 0
3: 14
4: 170
Right 979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 197
979675293_979675301 15 Left 979675293 4:123402748-123402770 CCTGGCTCCCACTTTCAACAAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 197
979675295_979675301 7 Left 979675295 4:123402756-123402778 CCACTTTCAACAAGAGCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 146
Right 979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979675301 Original CRISPR TTGAGGGTATTGAGAGCCAG TGG Exonic
902116295 1:14124380-14124402 ATGAGGCTAGAGAGAGCCAGCGG - Intergenic
903654138 1:24938663-24938685 GTGATGGTATTAAGAGGCAGTGG + Intronic
903819998 1:26094808-26094830 TAGTGGGTGGTGAGAGCCAGAGG + Intergenic
904800334 1:33088111-33088133 TTGATGGTATTTAAAGCCATGGG - Intronic
906299406 1:44671150-44671172 GAGAGGGTATTGAGAGACTGAGG + Intronic
907419911 1:54340353-54340375 TTGCTGCCATTGAGAGCCAGAGG + Intronic
910061670 1:83100968-83100990 TTGAGGATATTAAGCACCAGTGG + Intergenic
911057121 1:93718529-93718551 TTGAGGAAATTGAGGCCCAGAGG - Intronic
911238888 1:95442968-95442990 TAGAGGGTATTGAGAGGAAATGG + Intergenic
913338788 1:117735468-117735490 TTGTGGGTATTGGGGGCCTGGGG - Intergenic
916741811 1:167652442-167652464 TTGAGTGTATTTTCAGCCAGAGG + Intronic
918224605 1:182470244-182470266 TTGGGGGTGTTGAGAAGCAGTGG - Intronic
919859224 1:201728092-201728114 AGGAGTGTTTTGAGAGCCAGGGG - Intronic
921815186 1:219555523-219555545 TTGAGGGGAGGGAGAGCCAAAGG + Intergenic
923738227 1:236632003-236632025 TCGCAGGTATCGAGAGCCAGAGG + Intergenic
923938163 1:238788197-238788219 TTGATGATATTAAAAGCCAGAGG - Intergenic
1062810383 10:459177-459199 GGGAGGGTTCTGAGAGCCAGTGG - Intronic
1063166481 10:3468019-3468041 TTAAAAGTATTGAGAGACAGAGG - Intergenic
1065985140 10:30943318-30943340 TTGAGGGAATTCAGACCCAATGG + Intronic
1066997785 10:42579594-42579616 TTGAAGGTGTTGAGTCCCAGTGG - Intronic
1069061594 10:63900459-63900481 TTGAGGAAATTGAGACACAGAGG - Intergenic
1069848055 10:71386408-71386430 GTGAGGGTTCTGAGGGCCAGAGG + Intergenic
1070360693 10:75685628-75685650 TTGAGGGGATTGAAGTCCAGGGG + Intronic
1071269550 10:83994217-83994239 TTGAAGGTGTGGAGAGCCAAAGG - Intergenic
1073268625 10:102243236-102243258 CTGAGGGTCATGAGAGCAAGGGG - Intergenic
1074249198 10:111727026-111727048 ATGAGGGGATTGAGATCAAGAGG - Intergenic
1076634319 10:131872682-131872704 TTGAGGGAAGGGAGAGCCTGGGG - Intergenic
1076836642 10:133024324-133024346 ATGAGGTTGTTGTGAGCCAGGGG - Intergenic
1077453717 11:2665631-2665653 CTGAGGGCTTTGAGAGCCAAAGG - Intronic
1078822431 11:14895270-14895292 TTGAAGGAAGTGAGAGCCAAAGG + Intergenic
1079149668 11:17886114-17886136 ATGAGGGAACTGAGGGCCAGAGG - Intronic
1080007644 11:27426748-27426770 ATGAGGGAACTGAGACCCAGAGG + Intronic
1083599798 11:63939492-63939514 TGGAGGGAATTGAGGCCCAGAGG + Intronic
1084515232 11:69634385-69634407 TGAAGGTTATTGAGGGCCAGGGG - Intergenic
1084846818 11:71907393-71907415 ATGGGGGTCTTAAGAGCCAGGGG - Intronic
1085452462 11:76643174-76643196 TTGAGGGAAAGGAAAGCCAGTGG - Intergenic
1085675360 11:78512416-78512438 TTGATGGTAATGAGAGCCTCTGG - Intronic
1088782664 11:113151164-113151186 TTCAGGTCATTAAGAGCCAGAGG - Intronic
1092537539 12:9403399-9403421 ATGGGGGTCTTAAGAGCCAGGGG - Intergenic
1095088933 12:38086432-38086454 GTGAGGGTAGGGAGACCCAGGGG + Intergenic
1096006363 12:48175878-48175900 CTGAGGGTATTAAGAGACTGTGG + Intronic
1101017907 12:100520636-100520658 TTGAGGGTATTGAAAGGCAGGGG - Intronic
1101410462 12:104463678-104463700 TTGAGGGGTGTGAGAGGCAGGGG + Intronic
1102033871 12:109760016-109760038 CTGAGGGTCAGGAGAGCCAGTGG + Intronic
1104829792 12:131742275-131742297 TTGTGGGTAAAGAGAGCAAGTGG - Intronic
1107940452 13:45377481-45377503 ATGGGGGTCCTGAGAGCCAGGGG + Intergenic
1107941567 13:45381803-45381825 ATGGGGGTCCTGAGAGCCAGGGG + Intergenic
1108053079 13:46464308-46464330 ATTGGGGTCTTGAGAGCCAGGGG - Intergenic
1109814327 13:67560521-67560543 TTGTGAGTATTGTGAGGCAGGGG - Intergenic
1110892338 13:80707379-80707401 TTGGGGGTCCTAAGAGCCAGTGG - Intergenic
1111979060 13:94997910-94997932 TTGAGGGTTTTGAGAAACACTGG + Intergenic
1112394360 13:99014881-99014903 TGAAGGGTCTTGAGAGCGAGAGG - Intronic
1112668767 13:101610815-101610837 TTGAGTGTCTTGAGAATCAGAGG + Intronic
1113349644 13:109516323-109516345 TTGAGGGAACTGAGAGCAAGCGG - Intergenic
1117041719 14:51774482-51774504 ATGTGCGTCTTGAGAGCCAGGGG + Intergenic
1118600299 14:67467362-67467384 CTGAAGGTACTGACAGCCAGGGG + Intronic
1118981513 14:70720692-70720714 TTGAGGAAAGTGAGGGCCAGAGG - Intergenic
1119889662 14:78173404-78173426 TTGGGGGCATGGAGAGGCAGCGG + Intergenic
1121553276 14:94818535-94818557 TTGAGGGAACTGAGGCCCAGAGG + Intergenic
1122084275 14:99289047-99289069 TTGAGGCAGTTAAGAGCCAGTGG - Intergenic
1126776054 15:52101429-52101451 TTGAGGAAACTGAGACCCAGAGG - Intergenic
1127375742 15:58382821-58382843 GTCAGGGTATTTGGAGCCAGGGG + Intronic
1128521328 15:68376780-68376802 TTCAGGGTTTTGAGGGGCAGTGG + Intronic
1131176236 15:90211419-90211441 TTGGGGGTATTGTGTGCCAAGGG - Intronic
1135352261 16:21738947-21738969 TTGAGGGCAGTGGGAGCCAGTGG - Intronic
1135450751 16:22555069-22555091 TTGAGGGCAGTGGGAGCCAGTGG - Intergenic
1135626879 16:24003120-24003142 TGGAGGCTAGTAAGAGCCAGAGG - Intronic
1139677756 16:68536874-68536896 TTGAGTGTGATGAGAGCCATTGG - Intronic
1142626130 17:1193269-1193291 TTGTGGGTATTGAGGGGGAGGGG - Intronic
1143110715 17:4551355-4551377 TTGTGGGCATGGATAGCCAGCGG - Intronic
1143341289 17:6213356-6213378 GAGAGGGTGTTGAGAGGCAGTGG + Intergenic
1143677498 17:8446351-8446373 TTGAGGGTATTTAGTGTCTGGGG + Intronic
1145971860 17:28960852-28960874 TTGAGGCTCCTGAGGGCCAGCGG - Exonic
1146820793 17:35982449-35982471 TTGAGGGCAGTGGGAGGCAGGGG + Intergenic
1148182419 17:45616118-45616140 TTGAGAGAACTGAGAGACAGAGG + Intergenic
1148266437 17:46229579-46229601 TTGAGAGAACTGAGAGACAGAGG - Intergenic
1148782790 17:50130820-50130842 TGGAGGCTATTGAGGGCCGGTGG + Intergenic
1151018290 17:70582977-70582999 TTGAGAGTACAGAGAGCAAGAGG + Intergenic
1151258573 17:72899061-72899083 TTGGGTTTATTAAGAGCCAGCGG - Intronic
1154222636 18:12470424-12470446 TTGTGGGTATTCAGGGACAGTGG - Intronic
1155535032 18:26808248-26808270 TTAAGGGTATTGAGACAAAGAGG - Intergenic
1156887726 18:42155108-42155130 ATCAGGGTATTGAAACCCAGTGG + Intergenic
1157296298 18:46447717-46447739 TTGCGCCTATTGAGTGCCAGTGG + Intronic
1157626945 18:49058820-49058842 TTGGGGTTATTTAGAGCAAGAGG + Intronic
1158087722 18:53672995-53673017 TTGAGGTTTGGGAGAGCCAGTGG + Intergenic
1158422101 18:57304273-57304295 GTGAGGATATTGAGACCCAGAGG + Intergenic
1158763487 18:60419099-60419121 TGGAGGATTTTCAGAGCCAGTGG + Intergenic
1160334987 18:78031048-78031070 TAGGGGGGCTTGAGAGCCAGGGG + Intergenic
1160376715 18:78419507-78419529 TTGAGGCTAGAGAGAGCCCGGGG + Intergenic
1160781029 19:878062-878084 TGGGGGGCATTGACAGCCAGGGG - Intronic
1160781160 19:878478-878500 TGGTGGGCATTGACAGCCAGGGG - Intronic
1160781322 19:878980-879002 TGGTGGGCATTGATAGCCAGGGG - Intronic
1160781362 19:879104-879126 TGGGGGGTATTGACAACCAGGGG - Intronic
1160781552 19:879796-879818 TGGTGGGGATTGACAGCCAGGGG - Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161516260 19:4698239-4698261 TCCAGGGTATTGAGAGATAGGGG + Intronic
1163676716 19:18659026-18659048 TAGAGGGTACAGAGACCCAGAGG - Intronic
1164406643 19:27953928-27953950 TTGATGGTAATGGGAGCCACTGG + Intergenic
925330767 2:3056877-3056899 CTGAGGGAATTGAGAGGCAAGGG - Intergenic
926169472 2:10543133-10543155 TTGAGATTATTGAGAGCGAAAGG + Intergenic
926537708 2:14133663-14133685 CAGAGGGCATTGAAAGCCAGTGG + Intergenic
929781187 2:44958217-44958239 TTGAGGGAATTGAGGGCCTGAGG + Intergenic
929941266 2:46335808-46335830 TTGAGGATATGGATATCCAGAGG + Intronic
931614837 2:64144885-64144907 TTGAGGGAAGTGAGGGACAGAGG - Intergenic
933847314 2:86336824-86336846 TGCAGGGGATTGAGAGACAGGGG - Intronic
934879530 2:97963263-97963285 TTCAGGGTATTAAGAGCCCAGGG - Intronic
936602915 2:113917249-113917271 TTGAGGGCCCTGAGATCCAGTGG - Intronic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
944528351 2:200642876-200642898 TTGAGGAATTTGAGACCCAGAGG + Intronic
946113897 2:217445140-217445162 ATGAGGCTAGTGATAGCCAGAGG + Intronic
946565917 2:220965785-220965807 TTGAAGGTTTAGAGAGCCTGTGG + Intergenic
947287078 2:228528845-228528867 TTTAGGGAATTTAGAGCCATAGG + Intergenic
948058701 2:235028235-235028257 TAGGGGGTCTTGAGATCCAGTGG + Intronic
948723387 2:239917782-239917804 CTGAGTGCATTCAGAGCCAGCGG - Intronic
948932540 2:241141456-241141478 CTGAGGGTTTTGGGAGCCATTGG - Intronic
1169081582 20:2800572-2800594 TGGCGGGGATTGAGTGCCAGGGG + Exonic
1169800734 20:9508947-9508969 TTGAGGACATCGCGAGCCAGAGG + Intergenic
1172804879 20:37604640-37604662 GTGAGGATAATGGGAGCCAGAGG - Intergenic
1173879344 20:46399822-46399844 TAGAGGGTATTGGGACGCAGAGG - Intronic
1175369982 20:58481692-58481714 TTGGGGCGATTGGGAGCCAGTGG + Intronic
1176082487 20:63281021-63281043 TTGAGGGTGGTGGGAGCCACGGG + Intronic
1177362319 21:20088872-20088894 TTGAGGCTACTGTGAGCCAAAGG + Intergenic
1180910178 22:19444416-19444438 TTGAGGGTGCTCAGAGCCTGGGG - Intronic
1184784574 22:46665484-46665506 CTGAGTGTCTGGAGAGCCAGCGG + Intronic
1184983951 22:48116650-48116672 TTGGGGGGGTTGAGAGGCAGGGG + Intergenic
1185109644 22:48893851-48893873 TAGAGGGTATGGGGAGGCAGAGG + Intergenic
949884156 3:8681215-8681237 ATGGGGGTCCTGAGAGCCAGGGG - Intronic
950115915 3:10450325-10450347 TTAAGGGTAGTGAGAGAAAGAGG - Intronic
950374109 3:12556473-12556495 TGCAGGGTATAGAGAGCTAGAGG + Intronic
950393316 3:12713994-12714016 ATGAGGCTGTTGAGAGCCAGAGG + Intergenic
954144313 3:48626779-48626801 TTGAGGGTTTGGGGAGTCAGAGG + Intronic
958494665 3:94829346-94829368 TTCAGGGGAGTGAGAGGCAGTGG + Intergenic
958510370 3:95039010-95039032 GTGAGGGTATTGGGAGGCCGAGG - Intergenic
960220724 3:115105583-115105605 TTGAACGTATTGAGAGCTATGGG - Intronic
961134379 3:124496319-124496341 TGGAGGATATTGACAGCCAGGGG + Exonic
961380500 3:126493550-126493572 ATGAGGTTGTTGAGTGCCAGGGG + Intronic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
963874677 3:150462174-150462196 TTGAAGGTCATAAGAGCCAGAGG + Exonic
964708045 3:159642002-159642024 TGGAGGAGATTTAGAGCCAGAGG + Intronic
969586656 4:8097808-8097830 ATGAGGGCATGGAGACCCAGAGG - Intronic
970837100 4:20422593-20422615 TTTAGTGTAATGAGAGGCAGTGG + Intronic
973290145 4:48463013-48463035 TTGGGAGTATTGAAAGCCAAGGG - Intergenic
974695558 4:65365124-65365146 TTAAGGGTTTTGATAGCCACAGG + Exonic
975845839 4:78524394-78524416 TTCAGGGAAGAGAGAGCCAGAGG + Intronic
976365576 4:84229350-84229372 GTGAGGGTATTAATACCCAGGGG - Intergenic
977080180 4:92516788-92516810 ATGAGAGTGTCGAGAGCCAGTGG - Intronic
979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG + Exonic
983382793 4:167018944-167018966 TTGAGGGACTTGAGAACTAGTGG - Intronic
983472809 4:168177148-168177170 CTGAGGGTTATGAGGGCCAGTGG - Intronic
983894928 4:173071239-173071261 TGGAGGCTATTGGGAACCAGGGG + Intergenic
986404885 5:7415944-7415966 ATGGGGACATTGAGAGCCAGGGG + Intronic
986551933 5:8966549-8966571 TTGTATGTATTGAGAGCCAAGGG + Intergenic
987789538 5:22547303-22547325 TTGAGAATATTGAGAGACATGGG + Intronic
989004160 5:36791230-36791252 TTGAGGGCATTGAGTGGGAGTGG - Intergenic
990130732 5:52579915-52579937 TTGGGCGTATTGATAGCCACTGG - Intergenic
991149047 5:63344651-63344673 CTGAGGGTTTTGAGAGAGAGTGG + Intergenic
991461406 5:66863214-66863236 TTCTGGGAAGTGAGAGCCAGAGG + Intronic
991959058 5:72023382-72023404 ATGACAGCATTGAGAGCCAGGGG - Intergenic
992067369 5:73120415-73120437 GCGAGGGAATGGAGAGCCAGGGG - Exonic
992980149 5:82161294-82161316 TTGTGGGTTGTGAAAGCCAGGGG - Intronic
995321521 5:110839791-110839813 ATGAGGGTATTGACAGTTAGGGG - Intergenic
996520396 5:124419770-124419792 TTGAGGGCTTTGAGAGCAACTGG + Intergenic
997388682 5:133495999-133496021 TTGAGGATGTTCAGAGGCAGAGG + Intronic
997922268 5:137993202-137993224 ATGAGGATTTTGAGAGCCACTGG + Intronic
998094683 5:139390544-139390566 TGGAGGGTGTTGAGAGGCTGTGG + Intergenic
998875849 5:146598442-146598464 TAGAGGGTATTTAAAGCCATAGG - Intronic
1000881552 5:166703674-166703696 TTTAGGGTATTGAAAGCCTTAGG - Intergenic
1004341024 6:14807490-14807512 TTGAGGTTATTGAGAGCACCAGG - Intergenic
1005603800 6:27454880-27454902 TCGAGGGTGTTGACAACCAGGGG + Intronic
1007943759 6:45806744-45806766 TAGATGGCATTGAGAGCCATAGG + Intergenic
1012696961 6:102397053-102397075 TTGAGGCTATTGCGAGCAAGTGG + Intergenic
1012709537 6:102581912-102581934 TTGAAGGTAGTGAGTGCCAGGGG - Intergenic
1013352648 6:109319333-109319355 TGGAGAGTATTGAGAACCAGGGG + Intergenic
1017165335 6:151402629-151402651 TTGAGGACTTTGGGAGCCAGTGG + Intergenic
1018283019 6:162207690-162207712 GTGAGCGCATTGAGGGCCAGTGG - Intronic
1020638583 7:10727344-10727366 TTCAGGCTATTGAAAGCCTGTGG - Intergenic
1022057365 7:26752307-26752329 TTGAGGACATTGAGAACCATGGG - Intronic
1028720246 7:94022490-94022512 GTGAGTGTATTGGGAGCAAGGGG + Intergenic
1030298175 7:107949555-107949577 TAGAAGGTATTGAAATCCAGTGG - Intronic
1031028662 7:116711256-116711278 TTGAGGGTTTTCTGAGCCACTGG - Intronic
1034305340 7:150041812-150041834 ATGGGGGTACTAAGAGCCAGGGG + Intergenic
1034801613 7:154059161-154059183 ATGGGGGTATTAACAGCCAGGGG - Intronic
1034802828 7:154063492-154063514 ATGGGGGTCTTAAGAGCCAGGGG - Intronic
1036262703 8:7253214-7253236 ATGGGGGTCCTGAGAGCCAGGGG + Intergenic
1036303882 8:7586344-7586366 ATGGGGGTCCTGAGAGCCAGGGG - Intergenic
1036314743 8:7711753-7711775 ATGGGGGTCCTGAGAGCCAGGGG + Intergenic
1036354739 8:8034336-8034358 ATGGGGGTCCTGAGAGCCAGCGG - Intergenic
1037260828 8:17006200-17006222 TTGAAGCTAATGAGAGCTAGGGG + Intergenic
1037474918 8:19247712-19247734 TTGAGAATAATGAAAGCCAGTGG + Intergenic
1038176605 8:25185855-25185877 TTGAAGTTATTGAGGGCCTGTGG + Intronic
1041413148 8:57578578-57578600 TTCAGGATATTTACAGCCAGTGG + Intergenic
1042579345 8:70259210-70259232 TTCAGGGGATTGAGAGAGAGGGG - Intronic
1045695184 8:104801187-104801209 TTAAGGGCAATGAGAGCCACTGG + Intronic
1046888348 8:119393875-119393897 TTGAAGCCATTGAAAGCCAGTGG + Intergenic
1049163451 8:141112116-141112138 TTGAGGGCACTGGGAGCCACTGG + Intergenic
1049258102 8:141624603-141624625 GTGGCCGTATTGAGAGCCAGTGG - Intergenic
1051725543 9:20084894-20084916 TTGAGGGTTTTGAGAGCTACAGG + Intergenic
1052783459 9:32804851-32804873 TTCAGGGAATTTATAGCCAGTGG + Intergenic
1053129943 9:35609160-35609182 ATGAGGGTAGTGAGCGGCAGCGG - Exonic
1053289237 9:36869041-36869063 CTCAGGGCAGTGAGAGCCAGTGG - Intronic
1056279498 9:85027422-85027444 TTGAAGGTAGTGAGAGTAAGTGG + Intergenic
1056432382 9:86540602-86540624 TAGAAGGTATTTAGAGCCATAGG + Intergenic
1057195489 9:93113933-93113955 TTCAGGGAACTGAGGGCCAGGGG + Intergenic
1061040474 9:128138562-128138584 ATGGGGGTCTTAAGAGCCAGTGG + Intergenic
1186557867 X:10579644-10579666 TTCAGGGTATTGTGAGCAAAAGG - Intronic
1187622617 X:21075060-21075082 TCCAGGTTATGGAGAGCCAGAGG + Intergenic
1188690776 X:33125921-33125943 TTGAGGGTTTTGGGAGGCTGAGG + Intronic
1189087819 X:38046045-38046067 TTTAATATATTGAGAGCCAGTGG + Intronic
1191758716 X:64624085-64624107 TTGAGGGTCTTAAAGGCCAGAGG + Intergenic
1198002946 X:132458696-132458718 GTAATGGTATTGAGAGGCAGTGG - Intronic