ID: 979689350

View in Genome Browser
Species Human (GRCh38)
Location 4:123544025-123544047
Sequence CTGCTAGTCCCAGAGTTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979689347_979689350 2 Left 979689347 4:123544000-123544022 CCATAGTGGAGGTACTCAGAAGT No data
Right 979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG No data
979689344_979689350 19 Left 979689344 4:123543983-123544005 CCAGAGAATTATCAGTACCATAG No data
Right 979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979689350 Original CRISPR CTGCTAGTCCCAGAGTTTGG CGG Intergenic
No off target data available for this crispr