ID: 979690424

View in Genome Browser
Species Human (GRCh38)
Location 4:123553430-123553452
Sequence CCAGGCTCGCCCATTTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979690418_979690424 7 Left 979690418 4:123553400-123553422 CCTCCTTTGAGCCTGTGCTGCTA No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690415_979690424 25 Left 979690415 4:123553382-123553404 CCCCTTAGCAAGTGCTCTCCTCC No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690419_979690424 4 Left 979690419 4:123553403-123553425 CCTTTGAGCCTGTGCTGCTATTA No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690414_979690424 29 Left 979690414 4:123553378-123553400 CCAGCCCCTTAGCAAGTGCTCTC No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690417_979690424 23 Left 979690417 4:123553384-123553406 CCTTAGCAAGTGCTCTCCTCCTT No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690416_979690424 24 Left 979690416 4:123553383-123553405 CCCTTAGCAAGTGCTCTCCTCCT No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data
979690420_979690424 -4 Left 979690420 4:123553411-123553433 CCTGTGCTGCTATTACACACCAG No data
Right 979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979690424 Original CRISPR CCAGGCTCGCCCATTTCCTA GGG Intergenic
No off target data available for this crispr