ID: 979692397

View in Genome Browser
Species Human (GRCh38)
Location 4:123573931-123573953
Sequence GACAGCCTTTTGAGGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979692397_979692401 7 Left 979692397 4:123573931-123573953 CCTCCAGTCCTCAAAAGGCTGTC No data
Right 979692401 4:123573961-123573983 GTACTAGAACCGTCAATCTTGGG No data
979692397_979692402 10 Left 979692397 4:123573931-123573953 CCTCCAGTCCTCAAAAGGCTGTC No data
Right 979692402 4:123573964-123573986 CTAGAACCGTCAATCTTGGGAGG No data
979692397_979692404 19 Left 979692397 4:123573931-123573953 CCTCCAGTCCTCAAAAGGCTGTC No data
Right 979692404 4:123573973-123573995 TCAATCTTGGGAGGTTTTGTAGG No data
979692397_979692400 6 Left 979692397 4:123573931-123573953 CCTCCAGTCCTCAAAAGGCTGTC No data
Right 979692400 4:123573960-123573982 AGTACTAGAACCGTCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979692397 Original CRISPR GACAGCCTTTTGAGGACTGG AGG (reversed) Intergenic
No off target data available for this crispr