ID: 979698311

View in Genome Browser
Species Human (GRCh38)
Location 4:123639241-123639263
Sequence GAGACAGATGTGGGTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979698307_979698311 -5 Left 979698307 4:123639223-123639245 CCAGTAAGCCTGACTGCTGAGAC No data
Right 979698311 4:123639241-123639263 GAGACAGATGTGGGTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979698311 Original CRISPR GAGACAGATGTGGGTCATTT TGG Intergenic
No off target data available for this crispr