ID: 979699039

View in Genome Browser
Species Human (GRCh38)
Location 4:123646592-123646614
Sequence TATCCCTGATCCAGCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979699039_979699046 30 Left 979699039 4:123646592-123646614 CCTCTTGGGCTGGATCAGGGATA No data
Right 979699046 4:123646645-123646667 GCAGTCGTTAAGTGCATCTTGGG No data
979699039_979699045 29 Left 979699039 4:123646592-123646614 CCTCTTGGGCTGGATCAGGGATA No data
Right 979699045 4:123646644-123646666 CGCAGTCGTTAAGTGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979699039 Original CRISPR TATCCCTGATCCAGCCCAAG AGG (reversed) Intergenic
No off target data available for this crispr