ID: 979699041

View in Genome Browser
Species Human (GRCh38)
Location 4:123646623-123646645
Sequence CGGAGACGTGGGTCGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979699041_979699046 -1 Left 979699041 4:123646623-123646645 CCTTGCATCGACCCACGTCTCCG No data
Right 979699046 4:123646645-123646667 GCAGTCGTTAAGTGCATCTTGGG No data
979699041_979699047 24 Left 979699041 4:123646623-123646645 CCTTGCATCGACCCACGTCTCCG No data
Right 979699047 4:123646670-123646692 TATCTTTCTAGATGAGCCTGAGG No data
979699041_979699045 -2 Left 979699041 4:123646623-123646645 CCTTGCATCGACCCACGTCTCCG No data
Right 979699045 4:123646644-123646666 CGCAGTCGTTAAGTGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979699041 Original CRISPR CGGAGACGTGGGTCGATGCA AGG (reversed) Intergenic