ID: 979699046

View in Genome Browser
Species Human (GRCh38)
Location 4:123646645-123646667
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979699039_979699046 30 Left 979699039 4:123646592-123646614 CCTCTTGGGCTGGATCAGGGATA No data
Right 979699046 4:123646645-123646667 GCAGTCGTTAAGTGCATCTTGGG No data
979699041_979699046 -1 Left 979699041 4:123646623-123646645 CCTTGCATCGACCCACGTCTCCG No data
Right 979699046 4:123646645-123646667 GCAGTCGTTAAGTGCATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type