ID: 979710410

View in Genome Browser
Species Human (GRCh38)
Location 4:123772660-123772682
Sequence CTGGCTGTACACACGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979710403_979710410 -5 Left 979710403 4:123772642-123772664 CCCAGTAGGTGTGTTTCCCTGGC No data
Right 979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG No data
979710404_979710410 -6 Left 979710404 4:123772643-123772665 CCAGTAGGTGTGTTTCCCTGGCT No data
Right 979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG No data
979710399_979710410 28 Left 979710399 4:123772609-123772631 CCTGGTTTAGAAGTGGGGTGGTG No data
Right 979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG No data
979710401_979710410 -2 Left 979710401 4:123772639-123772661 CCTCCCAGTAGGTGTGTTTCCCT No data
Right 979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979710410 Original CRISPR CTGGCTGTACACACGCATGG GGG Intergenic
No off target data available for this crispr