ID: 979710446

View in Genome Browser
Species Human (GRCh38)
Location 4:123772953-123772975
Sequence CACCCTTGGCGTAATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979710443_979710446 -4 Left 979710443 4:123772934-123772956 CCTGACATAGAGAAATTTACACC No data
Right 979710446 4:123772953-123772975 CACCCTTGGCGTAATCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979710446 Original CRISPR CACCCTTGGCGTAATCCTGG AGG Intergenic
No off target data available for this crispr