ID: 979711229

View in Genome Browser
Species Human (GRCh38)
Location 4:123781829-123781851
Sequence TCTGATCTTTAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979711225_979711229 -9 Left 979711225 4:123781815-123781837 CCTTGACACTAGAGTCTGATCTT No data
Right 979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG No data
979711224_979711229 14 Left 979711224 4:123781792-123781814 CCATTAAAGATGTTAGAATTTTG No data
Right 979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG No data
979711223_979711229 20 Left 979711223 4:123781786-123781808 CCTGTACCATTAAAGATGTTAGA No data
Right 979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979711229 Original CRISPR TCTGATCTTTAGGAGGAGGA AGG Intergenic
No off target data available for this crispr