ID: 979715749

View in Genome Browser
Species Human (GRCh38)
Location 4:123835261-123835283
Sequence GCGCTAGTGCACCTCGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979715746_979715749 8 Left 979715746 4:123835230-123835252 CCTGGGAGGCAGAGCTTGCAGTG No data
Right 979715749 4:123835261-123835283 GCGCTAGTGCACCTCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979715749 Original CRISPR GCGCTAGTGCACCTCGGCCT GGG Intergenic