ID: 979715910

View in Genome Browser
Species Human (GRCh38)
Location 4:123837616-123837638
Sequence TGTACCAGTTCCCCTGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979715910_979715914 -2 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715914 4:123837637-123837659 CACCATTGCTGAAACTGGTGTGG No data
979715910_979715918 10 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715918 4:123837649-123837671 AACTGGTGTGGGGTCTTGCATGG No data
979715910_979715913 -7 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715913 4:123837632-123837654 TGGTACACCATTGCTGAAACTGG No data
979715910_979715919 17 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715919 4:123837656-123837678 GTGGGGTCTTGCATGGTTGAAGG No data
979715910_979715915 -1 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715915 4:123837638-123837660 ACCATTGCTGAAACTGGTGTGGG No data
979715910_979715917 0 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979715910 Original CRISPR TGTACCAGTTCCCCTGGACA GGG (reversed) Intergenic
No off target data available for this crispr