ID: 979715914

View in Genome Browser
Species Human (GRCh38)
Location 4:123837637-123837659
Sequence CACCATTGCTGAAACTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979715910_979715914 -2 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715914 4:123837637-123837659 CACCATTGCTGAAACTGGTGTGG No data
979715911_979715914 -3 Left 979715911 4:123837617-123837639 CCTGTCCAGGGGAACTGGTACAC No data
Right 979715914 4:123837637-123837659 CACCATTGCTGAAACTGGTGTGG No data
979715912_979715914 -8 Left 979715912 4:123837622-123837644 CCAGGGGAACTGGTACACCATTG No data
Right 979715914 4:123837637-123837659 CACCATTGCTGAAACTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979715914 Original CRISPR CACCATTGCTGAAACTGGTG TGG Intergenic
No off target data available for this crispr