ID: 979715917

View in Genome Browser
Species Human (GRCh38)
Location 4:123837639-123837661
Sequence CCATTGCTGAAACTGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979715911_979715917 -1 Left 979715911 4:123837617-123837639 CCTGTCCAGGGGAACTGGTACAC No data
Right 979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG No data
979715912_979715917 -6 Left 979715912 4:123837622-123837644 CCAGGGGAACTGGTACACCATTG No data
Right 979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG No data
979715910_979715917 0 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979715917 Original CRISPR CCATTGCTGAAACTGGTGTG GGG Intergenic
No off target data available for this crispr