ID: 979715919

View in Genome Browser
Species Human (GRCh38)
Location 4:123837656-123837678
Sequence GTGGGGTCTTGCATGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979715910_979715919 17 Left 979715910 4:123837616-123837638 CCCTGTCCAGGGGAACTGGTACA No data
Right 979715919 4:123837656-123837678 GTGGGGTCTTGCATGGTTGAAGG No data
979715911_979715919 16 Left 979715911 4:123837617-123837639 CCTGTCCAGGGGAACTGGTACAC No data
Right 979715919 4:123837656-123837678 GTGGGGTCTTGCATGGTTGAAGG No data
979715916_979715919 -6 Left 979715916 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG No data
Right 979715919 4:123837656-123837678 GTGGGGTCTTGCATGGTTGAAGG No data
979715912_979715919 11 Left 979715912 4:123837622-123837644 CCAGGGGAACTGGTACACCATTG No data
Right 979715919 4:123837656-123837678 GTGGGGTCTTGCATGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979715919 Original CRISPR GTGGGGTCTTGCATGGTTGA AGG Intergenic
No off target data available for this crispr