ID: 979728790

View in Genome Browser
Species Human (GRCh38)
Location 4:123996609-123996631
Sequence CAGAGTCATGTCTGCAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979728790_979728791 17 Left 979728790 4:123996609-123996631 CCTAACTTGCAGACATGACTCTG No data
Right 979728791 4:123996649-123996671 ACAAAAATAGTATTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979728790 Original CRISPR CAGAGTCATGTCTGCAAGTT AGG (reversed) Intergenic
No off target data available for this crispr