ID: 979728791

View in Genome Browser
Species Human (GRCh38)
Location 4:123996649-123996671
Sequence ACAAAAATAGTATTTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979728789_979728791 23 Left 979728789 4:123996603-123996625 CCTTATCCTAACTTGCAGACATG No data
Right 979728791 4:123996649-123996671 ACAAAAATAGTATTTTTTTCTGG No data
979728787_979728791 29 Left 979728787 4:123996597-123996619 CCCATACCTTATCCTAACTTGCA No data
Right 979728791 4:123996649-123996671 ACAAAAATAGTATTTTTTTCTGG No data
979728788_979728791 28 Left 979728788 4:123996598-123996620 CCATACCTTATCCTAACTTGCAG No data
Right 979728791 4:123996649-123996671 ACAAAAATAGTATTTTTTTCTGG No data
979728790_979728791 17 Left 979728790 4:123996609-123996631 CCTAACTTGCAGACATGACTCTG No data
Right 979728791 4:123996649-123996671 ACAAAAATAGTATTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979728791 Original CRISPR ACAAAAATAGTATTTTTTTC TGG Intergenic
No off target data available for this crispr