ID: 979729262

View in Genome Browser
Species Human (GRCh38)
Location 4:124003941-124003963
Sequence ATTTTTGAACAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979729258_979729262 -2 Left 979729258 4:124003920-124003942 CCTTGGGTGGAAAATGAGAGGAT No data
Right 979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979729262 Original CRISPR ATTTTTGAACAGAGGGAGGA AGG Intergenic
No off target data available for this crispr