ID: 979732773

View in Genome Browser
Species Human (GRCh38)
Location 4:124045055-124045077
Sequence TAGCTGCCCCTTGGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979732766_979732773 2 Left 979732766 4:124045030-124045052 CCCAGACCTGTGTAATGAAGCAC No data
Right 979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG No data
979732767_979732773 1 Left 979732767 4:124045031-124045053 CCAGACCTGTGTAATGAAGCACT No data
Right 979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG No data
979732768_979732773 -4 Left 979732768 4:124045036-124045058 CCTGTGTAATGAAGCACTCTAGC No data
Right 979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG No data
979732764_979732773 23 Left 979732764 4:124045009-124045031 CCCAGGCAGGAGGCACGGGATCC No data
Right 979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG No data
979732765_979732773 22 Left 979732765 4:124045010-124045032 CCAGGCAGGAGGCACGGGATCCC No data
Right 979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979732773 Original CRISPR TAGCTGCCCCTTGGCAGAGG GGG Intergenic
No off target data available for this crispr