ID: 979736458

View in Genome Browser
Species Human (GRCh38)
Location 4:124091849-124091871
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979736455_979736458 5 Left 979736455 4:124091821-124091843 CCAATATATTACAACGAGGAGGA No data
Right 979736458 4:124091849-124091871 ATATATTACAATGAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr