ID: 979748644

View in Genome Browser
Species Human (GRCh38)
Location 4:124248049-124248071
Sequence CTAGCTTATCCTGTTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979748644_979748646 10 Left 979748644 4:124248049-124248071 CCCATGTCAACAGGATAAGCTAG No data
Right 979748646 4:124248082-124248104 GTAATGTGTCTGTGCTACAAAGG No data
979748644_979748647 17 Left 979748644 4:124248049-124248071 CCCATGTCAACAGGATAAGCTAG No data
Right 979748647 4:124248089-124248111 GTCTGTGCTACAAAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979748644 Original CRISPR CTAGCTTATCCTGTTGACAT GGG (reversed) Intergenic
No off target data available for this crispr