ID: 979749382

View in Genome Browser
Species Human (GRCh38)
Location 4:124258675-124258697
Sequence GTTTTTATTGTGGTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979749375_979749382 29 Left 979749375 4:124258623-124258645 CCAAGTTATCTGAAAATGGTTTC No data
Right 979749382 4:124258675-124258697 GTTTTTATTGTGGTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979749382 Original CRISPR GTTTTTATTGTGGTTGTGGA TGG Intergenic
No off target data available for this crispr