ID: 979751184

View in Genome Browser
Species Human (GRCh38)
Location 4:124280852-124280874
Sequence AAGAGTAAACTTAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979751178_979751184 8 Left 979751178 4:124280821-124280843 CCCTTCTCTTTACATTGTCTCTC No data
Right 979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG No data
979751176_979751184 28 Left 979751176 4:124280801-124280823 CCCTTACTTGCTTCTCTAGACCC No data
Right 979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG No data
979751179_979751184 7 Left 979751179 4:124280822-124280844 CCTTCTCTTTACATTGTCTCTCT No data
Right 979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG No data
979751177_979751184 27 Left 979751177 4:124280802-124280824 CCTTACTTGCTTCTCTAGACCCT No data
Right 979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979751184 Original CRISPR AAGAGTAAACTTAGGGATGG AGG Intergenic
No off target data available for this crispr