ID: 979752167

View in Genome Browser
Species Human (GRCh38)
Location 4:124291981-124292003
Sequence ACATGGCAAGAGAGGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979752167_979752177 28 Left 979752167 4:124291981-124292003 CCCCGCTCCCTCTCTTGCCATGT No data
Right 979752177 4:124292032-124292054 CCATGAGTAAAAGCTTCCAGAGG 0: 4
1: 184
2: 566
3: 1194
4: 3975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979752167 Original CRISPR ACATGGCAAGAGAGGGAGCG GGG (reversed) Intergenic
No off target data available for this crispr