ID: 979752167 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:124291981-124292003 |
| Sequence | ACATGGCAAGAGAGGGAGCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 979752167_979752177 | 28 | Left | 979752167 | 4:124291981-124292003 | CCCCGCTCCCTCTCTTGCCATGT | No data | ||
| Right | 979752177 | 4:124292032-124292054 | CCATGAGTAAAAGCTTCCAGAGG | 0: 4 1: 184 2: 566 3: 1194 4: 3975 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 979752167 | Original CRISPR | ACATGGCAAGAGAGGGAGCG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||