ID: 979761485

View in Genome Browser
Species Human (GRCh38)
Location 4:124410677-124410699
Sequence TCTAATCTTTAGTAAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979761481_979761485 15 Left 979761481 4:124410639-124410661 CCTCTCTTATGTGGCCATGCTTG No data
Right 979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG No data
979761483_979761485 1 Left 979761483 4:124410653-124410675 CCATGCTTGGCTTGCCTATGCTA No data
Right 979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG No data
979761478_979761485 29 Left 979761478 4:124410625-124410647 CCTCAGTCACTCACCCTCTCTTA No data
Right 979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG No data
979761480_979761485 16 Left 979761480 4:124410638-124410660 CCCTCTCTTATGTGGCCATGCTT No data
Right 979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979761485 Original CRISPR TCTAATCTTTAGTAAGCATA TGG Intergenic
No off target data available for this crispr