ID: 979764599

View in Genome Browser
Species Human (GRCh38)
Location 4:124448476-124448498
Sequence CCAGCCAATCCTGGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979764586_979764599 21 Left 979764586 4:124448432-124448454 CCCTCACTTACTCTTTCCCTGTA No data
Right 979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG No data
979764592_979764599 4 Left 979764592 4:124448449-124448471 CCTGTACTGGGGAAACTTTCCAG No data
Right 979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG No data
979764591_979764599 5 Left 979764591 4:124448448-124448470 CCCTGTACTGGGGAAACTTTCCA No data
Right 979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG No data
979764587_979764599 20 Left 979764587 4:124448433-124448455 CCTCACTTACTCTTTCCCTGTAC No data
Right 979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979764599 Original CRISPR CCAGCCAATCCTGGGTAAGC AGG Intergenic
No off target data available for this crispr