ID: 979767015

View in Genome Browser
Species Human (GRCh38)
Location 4:124474542-124474564
Sequence GTCTTGCTCCAAAATCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979767015_979767019 27 Left 979767015 4:124474542-124474564 CCTGTAGGATTTTGGAGCAAGAC No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979767015 Original CRISPR GTCTTGCTCCAAAATCCTAC AGG (reversed) Intergenic
No off target data available for this crispr