ID: 979767016

View in Genome Browser
Species Human (GRCh38)
Location 4:124474564-124474586
Sequence GTTATCTGTAGAAGATGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979767016_979767022 17 Left 979767016 4:124474564-124474586 CCCTGCCATCTTCTACAGATAAC No data
Right 979767022 4:124474604-124474626 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
979767016_979767021 16 Left 979767016 4:124474564-124474586 CCCTGCCATCTTCTACAGATAAC No data
Right 979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
979767016_979767019 5 Left 979767016 4:124474564-124474586 CCCTGCCATCTTCTACAGATAAC No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data
979767016_979767023 23 Left 979767016 4:124474564-124474586 CCCTGCCATCTTCTACAGATAAC No data
Right 979767023 4:124474610-124474632 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979767016 Original CRISPR GTTATCTGTAGAAGATGGCA GGG (reversed) Intergenic
No off target data available for this crispr