ID: 979767017

View in Genome Browser
Species Human (GRCh38)
Location 4:124474565-124474587
Sequence AGTTATCTGTAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979767017_979767021 15 Left 979767017 4:124474565-124474587 CCTGCCATCTTCTACAGATAACT No data
Right 979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
979767017_979767023 22 Left 979767017 4:124474565-124474587 CCTGCCATCTTCTACAGATAACT No data
Right 979767023 4:124474610-124474632 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
979767017_979767022 16 Left 979767017 4:124474565-124474587 CCTGCCATCTTCTACAGATAACT No data
Right 979767022 4:124474604-124474626 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
979767017_979767019 4 Left 979767017 4:124474565-124474587 CCTGCCATCTTCTACAGATAACT No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979767017 Original CRISPR AGTTATCTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr