ID: 979767019

View in Genome Browser
Species Human (GRCh38)
Location 4:124474592-124474614
Sequence TCCTTTTAAGAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979767015_979767019 27 Left 979767015 4:124474542-124474564 CCTGTAGGATTTTGGAGCAAGAC No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data
979767017_979767019 4 Left 979767017 4:124474565-124474587 CCTGCCATCTTCTACAGATAACT No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data
979767018_979767019 0 Left 979767018 4:124474569-124474591 CCATCTTCTACAGATAACTAGTC No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data
979767016_979767019 5 Left 979767016 4:124474564-124474586 CCCTGCCATCTTCTACAGATAAC No data
Right 979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979767019 Original CRISPR TCCTTTTAAGAGACAGCTCT TGG Intergenic
No off target data available for this crispr