ID: 979767391

View in Genome Browser
Species Human (GRCh38)
Location 4:124478399-124478421
Sequence CAGAGTTTACAGAATGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979767391_979767396 21 Left 979767391 4:124478399-124478421 CCACAATCATTCTGTAAACTCTG No data
Right 979767396 4:124478443-124478465 TGAATAGCTATGAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979767391 Original CRISPR CAGAGTTTACAGAATGATTG TGG (reversed) Intergenic
No off target data available for this crispr