ID: 979772369

View in Genome Browser
Species Human (GRCh38)
Location 4:124543596-124543618
Sequence GAATCACTTAAAACAATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979772369_979772370 6 Left 979772369 4:124543596-124543618 CCAGGTATTGTTTTAAGTGATTC No data
Right 979772370 4:124543625-124543647 AACTGCTACTATTAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979772369 Original CRISPR GAATCACTTAAAACAATACC TGG (reversed) Intergenic
No off target data available for this crispr