ID: 979775397

View in Genome Browser
Species Human (GRCh38)
Location 4:124583187-124583209
Sequence CACCCCTCCCCCTGCGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979775397_979775398 -10 Left 979775397 4:124583187-124583209 CCAAACTCGCAGGGGGAGGGGTG No data
Right 979775398 4:124583200-124583222 GGGAGGGGTGACCAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979775397 Original CRISPR CACCCCTCCCCCTGCGAGTT TGG (reversed) Intergenic
No off target data available for this crispr