ID: 979775398

View in Genome Browser
Species Human (GRCh38)
Location 4:124583200-124583222
Sequence GGGAGGGGTGACCAGCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979775393_979775398 -6 Left 979775393 4:124583183-124583205 CCTACCAAACTCGCAGGGGGAGG No data
Right 979775398 4:124583200-124583222 GGGAGGGGTGACCAGCACCTTGG No data
979775387_979775398 26 Left 979775387 4:124583151-124583173 CCACTCAGCCTGTCAGCTGGAAT No data
Right 979775398 4:124583200-124583222 GGGAGGGGTGACCAGCACCTTGG No data
979775397_979775398 -10 Left 979775397 4:124583187-124583209 CCAAACTCGCAGGGGGAGGGGTG No data
Right 979775398 4:124583200-124583222 GGGAGGGGTGACCAGCACCTTGG No data
979775388_979775398 18 Left 979775388 4:124583159-124583181 CCTGTCAGCTGGAATCTGCTTAA No data
Right 979775398 4:124583200-124583222 GGGAGGGGTGACCAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979775398 Original CRISPR GGGAGGGGTGACCAGCACCT TGG Intergenic
No off target data available for this crispr